1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
babunello [35]
3 years ago
14

Please help will mark brainly and give 10 points

Biology
1 answer:
ozzi3 years ago
3 0

<em>The answer Is B.) It would have a shorter Stem</em>

You might be interested in
The two main processes by which plant cells absorb, release, and use energy are
emmainna [20.7K]
<em>The two main process by which plant cells absorb, release, and use energy are Photosynthesis and respiration.</em>
5 0
3 years ago
Read 2 more answers
HELP ASAP!!!! All life on earth has descended from a common ancestor this theory was accepted when
kap26 [50]

Answer:

A. A majority of scientists agreed with it

Explanation:

The famous theory called the theory of common descent, states that all the living organisms of the earth have arisen from a common ancestor. This notion was first proposed by a French mathematician,Louis Maupertuis duirng 1740s who was of the view that all organisms had a single ancestor and evolutionary process with the passage of time resulted in the specie diversification.

After that, in 1790s another philosopher Immanuel Kant, suggested that all organisms seem to have a common ancestor. In the same period of 1790s, another scientist , Erasmus Darwin who was the grandfather of Charles Darwin also suggested that all the organisms might have a single ancestor who went through the process of evolution to bring all the majesty into life.

Charles Darwin was the first scientist who worked on this notion for alot of time and proposed the theory of common descent,in his book, On the Origin of Species.

After it, many scientists got agree with this theory such as,  Vernon Kellogg in 1907 and T. Ryan Gregory in 2008 and many others explain that no reliable observations exists which contradicts the theory of common descent.

Therefore, option A is the best option.

Hope it helps!

4 0
3 years ago
Why did my fish drown
Ket [755]

Answer:

you forgot to feed it

Explanation:

7 0
3 years ago
Read 2 more answers
Take a look at the layers of earth and the fossils in each layer. The fossils show us that life forms changed in an area. Compar
frez [133]

The change in the environment affected how the organism would evolve to be so that it could survive. the term for that is survival of the fittest, and only the fittest would be able to survive the conditions of its surrounding environment. hope this answered your question. :)

5 0
3 years ago
Read 2 more answers
PLEASE HELP!
PIT_PIT [208]

Answer:

All the ones listed below are true

6 0
2 years ago
Other questions:
  • Why do offspring usually appear similar to their parents?
    12·2 answers
  • The Late ____________________ was a time of active mountain building.
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • How might a dramatic decrease in vegetation lead to a decrease in a prey species?
    9·1 answer
  • When the Barrel and Saguaro cacti absorb moisture they store it _______. a. in their roots b. in their spines c. in the flesh of
    13·2 answers
  • What is the function of DNA and where is it found in a eukaryote cell
    6·1 answer
  • Glycogen is an important and quickly mobilized source of stored glucose. Glucose is mobilized for ATP generation in muscle in re
    15·1 answer
  • Which ancient culture is not know for using geothermal energy?
    13·2 answers
  • Six friends were talking. They each had different ideas about why it is warmer in the summer than in the winter. This is what th
    6·1 answer
  • Some biological anthropologists analyze human remains to provide legal evidence. this special type of anthropology is known as:_
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!