1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IgorC [24]
3 years ago
15

AM I CORRECT??

Biology
2 answers:
Lerok [7]3 years ago
5 0
Yes A is the correct answer
Sveta_85 [38]3 years ago
5 0
Yes A is correct. <span>Water sources can get contaminated and infect large groups of people.</span>
You might be interested in
The process of combining two incomplete proteins to make a compete protein is called?
Allushta [10]

Answer:

Mutual supplementation

Explanation:

8 0
2 years ago
Why is DNA good at storing information
joja [24]
Its bases can be joined together in any order like the letters of the alphabet can be strung to form different words.
3 0
4 years ago
The number of domains kingdoms and classification levels
Kazeer [188]
There are three domains, and six kingdoms.
8 0
3 years ago
Names of these blood vessels
Alik [6]
Pulmonary vein

Aorta

Pulmonary artery

Vena cava
8 0
3 years ago
When you talk about carbohydrates in a diet, people mostly think of foods containing grains, like bread and pasta. What else in
andrew-mc [135]

Answer:

Carbohydrates are found in a wide array of both healthy and unhealthy food,bread, beans, milk, popcorn, potatoes, cookies, spaghetti, soft drinks, corn, and cherry pie. They also come in a mixture of forms. The usal  common and abundant forms are sugars, fibers, including starches.

Explanation:

6 0
3 years ago
Other questions:
  • Which of the following is not a factor influencing preventive measures used to combat the spread of disease? A. Antibiotics B. S
    13·2 answers
  • Help quick!! Give three examples of protist
    6·1 answer
  • How does diffusion occur in plants?
    9·1 answer
  • The burning of fossil fuels releases which of the following gases into the atmosphere?
    5·2 answers
  • What would you do if you found an alien in your living room? (Check all that apply.)
    7·2 answers
  • What do you put on the bottom of a branching tree
    13·1 answer
  • Which information is provided by absolute dating that cannot be provided by relative dating?
    11·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • How do littoral zones differ from riparian zones?
    7·1 answer
  • “Which is one function of a protein marcomolecule?”
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!