1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Taya2010 [7]
3 years ago
14

Factoriza C (x) 42x4 − 36x2 + 24x + 12

Mathematics
1 answer:
ki77a [65]3 years ago
7 0

Answer:

factor out 12

12(14cx - 5 + 2x)

You might be interested in
Application Question:
Alika [10]
When you add 4 to 25 you get 21 then subtract 11 and get 10 and then add 15 which is equal to 25 and then subtract 13.

the answer is 12
7 0
3 years ago
What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
Papessa [141]

Answer:

AATTGGCCATGCATGATTACGA

TTAACCGGTACGTACTAATGCT

Step-by-step explanation:

A's and T's, C's and G's. Just switch the letters for their partner.

8 0
3 years ago
Read 2 more answers
A number divided by -10 is -30 what is the number
Bad White [126]
------------------------------------------------------------------
Define x :
 ------------------------------------------------------------------
Let the number be x.

------------------------------------------------------------------
Construct Equation:
------------------------------------------------------------------
x ÷ (-10) = -30

------------------------------------------------------------------
Multiply for (-10) on both sides:
------------------------------------------------------------------
x = (-30) x (-10) = 300

------------------------------------------------------------------
Answer: x = 300
------------------------------------------------------------------
6 0
3 years ago
Someone help, I just need the answers, no explanation or non of that
liraira [26]

Answer:

5). x = 15

7). JL = 78

Step-by-step explanation:

We can solve these problems with the help of midsegment theorem.

Midsegment theorem:

"Segment joining midpoints of two sides of a triangle is parallel and half the measure of third side of the triangle"

Question 5

8x - 23 = \frac{1}{2}(10x+44)

8x - 23 = 5x + 22

8x - 5x = 22 + 23

3x = 45

x = 15

Therefore, x = 15 is the answer.

Question 7

Since, MN is the midsegment,

MN = \frac{1}{2}(JL)

5x - 16 = \frac{1}{2}(4x+34)

5x - 16 = 2x + 17

5x - 2x = 17 + 16

3x = 33

x = 11

Therefore, Length of JL = 4(11) + 34

                                        = 44 + 34

                                        = 78 units

5 0
3 years ago
Given that <br> f(n) = n^2 - 4n + 3 <br> &amp; g(n) = 2n - 1<br> find gf(-2)
icang [17]

Answer:

The value of gf\left(-2\right) will be:

  • gf\left(-2\right)=29

Step-by-step explanation:

Given the functions

f(n) = n^2 - 4n + 3

g\left(n\right)\:=\:2n\:-\:1

f\left(-2\right)\:=\:\left(-2\right)^2\:-\:4\left(-2\right)\:+\:3

           =\left(-2\right)^2+4\cdot \:2+3

           =2^2+4\cdot \:2+3

            =2^2+8+3

            =4+11

            =15

so

gf\left(-2\right)=g\left(15\right)

             =2n-1=2\left(15\right)-1=30-1=29

Therefore,

  • gf\left(-2\right)=29

3 0
3 years ago
Other questions:
  • How to change 783/32 into a mixed number?
    14·2 answers
  • Emma can run 100 meters in 20 seconds.She competed in a 400 meter race. How many seconds did it take her to run that race?
    7·2 answers
  • I need help for these fraction questions! I will give brainleist! Please!!
    10·2 answers
  • Which expression is equivalent to k‐10?
    11·1 answer
  • Plz help fast!!!!!!!
    8·1 answer
  • What is the solution to the compound inequality 5x−19≤1 OR −4x+3&lt;−6
    11·1 answer
  • the formula A=P(1+r)^2 gives the amount A in dollars that P dollars will grow to in 2 years at interest rate r (where r is given
    6·1 answer
  • Please Help!! <br> I really need to pass
    5·2 answers
  • Find the slope and the y intercept of the table
    12·1 answer
  • Combine like terms to create an equivalent expression. -3.6-1.9t+1.2+5.1t−3.6−1.9t+1.2+5.1tminus, 3, point, 6, minus, 1, point,
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!