All categories

4 years ago

What is the basic form of matter which cannot be broken down any further

Biology

1 answer:

LenKa [72]4 years ago

7 0

Answer:

Atom

Explanation:

An atom is the most simple and basic form of matter which cannot be broken down any further.

You might be interested in

Which of the following shows the importance of incoming solar energy for life on earth?

Vladimir [108]

The answer is A cuz a food chain starts with solar energy

3 0

4 years ago

Choose which tissue would line the uterine (fallopian) tubes and function as a "conveyor belt" to help move a fertilized egg tow

olchik [2.2K]

The ciliated simple columnar epithelium is a tissue that would line the uterine tubes and function as a conveyor belt to help move a fertilized egg toward the uterus. The ciliated columnar epithelium transfers mucus and constituents through cilia and is originate in the upper respiratory area the fallopian tubes, the uterus, and principal part of the spinal cord. It is the main objective of contamination for common cold illnesses.

7 0

4 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

The general who directed the project responsible for the "Fat Man” graduated from what alma mater in 1918?

Oliga [24]

<h3><u>Answer;</u></h3>

-The name of the general was Leslie Richard Groves Jr. He Graduated fourth in his class<u><em> in the U.S. Military Academy at West point.</em></u>

<h3><u>Explanation;</u></h3>

<u>The name of the general was Leslie Richard Groves Jr. He graduated from the United States Military Academy of West point in the year 1918.</u>

As an engineering aide, He led a small team of workers who helped produce the exterior casing of "Fat Man," a nuclear bomb dropped on Nagasaki, Japan, that hastened the Japanese unconditional surrender three weeks later.

6 0

3 years ago

Read 2 more answers

If you subtract the atomic number from the weight, what is the interpretation of the answer? (e.g. 14-7=7; Think of a subatomic

viva [34]

If we subtract the atomic number from the weight, we get the number of neutrons in the particle. This is because protons and neutrons each have a weight of 1, while electrons are 0. And since the atomic number is also the number of protons in the atom, subtracting it from total weight gives us the number iif neutrons.

4 0

3 years ago