1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
3 years ago
15

Which two organelles are involved in cellular energetics?

Biology
1 answer:
bearhunter [10]3 years ago
3 0
Chloroplast and mitochondria. Only mitochondria is an animal.
You might be interested in
What joins monomers by removing molecules of water
Firdavs [7]

Explanation:

this is cheeeeeeeeeeemistry

3 0
3 years ago
Why do Primary succession happen
Alja [10]

Answer:

Explanation: Primary succession occurs when new land is formed or bare rock is exposed, providing a habitat that can be colonized for the first time. For example, primary succession may take place following the eruption of volcanoes, such as those on the Big Island of Hawaii. As lava flows into the ocean, new rock is formed.

4 0
3 years ago
Sunlight is the ultimate source of energy in the ecosystem.​
Nezavi [6.7K]

Answer: yup. That, and water or air.

Explanation:

8 0
1 year ago
Read 2 more answers
How do the lymph and immune systems depend on the cardiovascular system?
kari74 [83]
The correct option is C.
The heart is part of the cardiovascular system. The heart pump the blood round the body several times in a day. The blood is made up of several types of cells which carry out specific function in the body, these include the white blood cells which serves as soldiers of the body. The lymph refers to the fluid that circulate throughout the lymphatic system. Both the blood and the lymph are carried round the body by the cardiovascular system during the process of circulation.<span />
7 0
3 years ago
Which example illustrates Darwin's main contribution to the theory of evolution? A. An agricultural pest has been exposed to a p
Svet_ta [14]
"When exposed to antibiotics, most bacteria in a population die but some survive and live to reproduce" is the one example that <span>illustrates Darwin's main contribution to the theory of evolution. The correct option among all the options that are given in the question is the third option or option "C". I hope it helps you.</span>
3 0
3 years ago
Read 2 more answers
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Which are early (prodromal) clinical manifestations of hepatitis?
    15·1 answer
  • Cells in organisms need food, air, and waste removal. How are these needs met? A. Each cell must specialize in all of these func
    5·2 answers
  • 5 ejemplos de punto de ebullicion
    14·1 answer
  • Pls answer real quick!!
    10·1 answer
  • How does the embryo get nourishment inside the mother's body?
    14·1 answer
  • Which plate boundaries and movements most commonly create earthquakes? Explain how earthquakes can be created by plate tectonics
    8·1 answer
  • Why aren't viruses considered living things?
    6·2 answers
  • Energy can be generally defined as the ____.
    13·1 answer
  • Can someone please help me with the next 15-20 questions that I'm about to upload today? they're all due today and it's for phys
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!