1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
2 years ago
5

earth’s inner core is solid because of _____. a. its great diameter b. immense pressure c. the composition of its rock d. extrem

e temperatures
Biology
2 answers:
oksian1 [2.3K]2 years ago
8 0
B, immense pressure causes the core to be very compacted and solid.
Luba_88 [7]2 years ago
6 0
<h2>Answer:</h2>

b. immense pressure

<h2>Explanation:</h2>

Although the inner core of earth has an immense temperature, yet the immense pressure present there keeps the core in solid form because a higher temperature with a high pressure is the evidence of elements like nickel and iron.  It is composed of an iron–nickel alloy and some other elements which are in solid form.

You might be interested in
1. In eukaryotic flagella, the fibers that slide past one another due to the activity of dynein proteins are microtubules. 2. Ma
yulyashka [42]

Answer:

1) In eukaryotic flagella, the fibers that slide past one another due to the activity of dynein proteins are microtubules.

2) Many cell organelles, most notably the nucleus, are anchored by intermediate filaments which are assembled from a diverse class of proteins.

3) Centrosomes are sites where protein dimers assemble into microtubules.

4) The extension of pseudopodia in amoeba is due to the regulated assembly and destruction of microfilaments.

5) The only cytoskeletal fibers not associated with intracellular movement or whole cell locomotion are the intermediate filaments.

6) During muscle contractions, myosin motor proteins move across tracks of microfilaments.

Explanation:

The cytoskeleton is a very important element of the cell, and is composed of three different structures: microtubules, intermediate filaments, and microfilaments.

<u>Microtubules</u> are structures in the shape of hollow tubes that <u>give shape to the cell</u>. Microtubules also participate in cell motility by <u>providing a route</u> for the organelles to move through.

Intermediate filaments are the only ones that do not participate in cell motility: their main function is to <u>provide mechanical support for the plasma membrane</u>.

Microfilaments are a key component in <u>cell motility</u>, and also associate with myosin (a protein) to produce <u>muscle contraction</u>. Microfilaments also give the cell the ability to grow <u>pseudopods</u>.

4 0
3 years ago
Read 2 more answers
What percentage of genetic material is the same in everyone?
nika2105 [10]
The answer is 99.9 percent.
8 0
2 years ago
A cold transmitted by a facial tissue is an example of fomite. vehicle transmission. droplet transmission. vector. direct contac
m_a_m_a [10]

Answer:

Direct contact.

Explanation:

Since it was spread through facial tissue, physical contact is needed.

Hope this helps! :)

4 0
2 years ago
The first open releasing the energy of glucose in the cell is known as
poizon [28]
<span>The first open releasing the energy of glucose in the cell is known as </span><span>Glycolysis. </span>

4 0
3 years ago
Rarefaction is used for which of the following?
ratelena [41]

Rarefaction in terms of ecology can be defined as a technique used to assess species richness from the results of sampling.

It allows the calculation of richness of a particular species for a given number of individual samples, and these are based on the construction of rarefaction curves.

Hence, the correct answer is: option A-Creating a representative sample

3 0
3 years ago
Read 2 more answers
Other questions:
  • During which phase of the cell cycle is the cytoplasm and its contents divided to form two new daughter cells?
    6·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Four friends were talking about human DNA, genes, and chromosomes. They each had different ideas about where these structures we
    8·1 answer
  • If an rna strand has 20 adenine, how many thymine would it have?
    10·1 answer
  • 1. Madison has type A blood, and so does her sister Abi. Her sister Marley has type O blood. A. What are Madison's parents' bloo
    6·1 answer
  • PLS HELP ASAP WILL GIVE BRAINLIEST
    10·1 answer
  • A student found a grasshopper in their backyard and wanted to take it to school to show the teacher the next day. The student pu
    11·1 answer
  • What is one reason some leaves are spiny or needle shaped
    6·1 answer
  • Pls help me its only 5 questions
    6·1 answer
  • Proteins to be secreted outside the cell are formed at ribosomes on the surface of the ______ endoplasmic reticulum.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!