1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Crazy boy [7]
2 years ago
13

What is the outcome of mitosis

Biology
2 answers:
Igoryamba2 years ago
8 0
<span> At the end of mitosis there is 4 daughter cells </span>
shusha [124]2 years ago
6 0

Answer:

The correct answer is the formation of two daughter cells with same genetic material.

Explanation:

Mitosis is a type of cell division which produces two genetically similar daughter cells with the same genetic material.  

This type of cell division takes place in somatic cells where ploidy or number or chromosome number remains the same. It is also a way of the asexual mode of reproduction which produces clones with the same genetic material.

Thus, the formation of two daughter cells with the same genetic material is the correct answer.

You might be interested in
Which does not occur when ATP is hydrolyzed?
tatuchka [14]

Answer:

I think the correct answer from the choices listed above is the third option. When ATP is hydrolyzed energy is not stored. Rather, it is released. Hope this answers the question. Have a nice day. Feel free to ask more questions.

Explanation:

Brainliest when you can!!

8 0
3 years ago
What is the correct amino acid sequence for the<br> mRNA code AUGCCAGUAUGA
dalvyx [7]

Answer:

UAC GGU CAU ACU

4 0
2 years ago
Replicate the following strand of DNA: AATCATGGA
Doss [256]

Answer:

UUAGUACCU

Explanation:

A ---> U

T ---> A

C ---> G

it's been a while since I did this stuff but I'm 99% sure it's correct

5 0
3 years ago
Read 2 more answers
Which pair shows processes that are the reverse of one another?
swat32
We need to see a list
5 0
3 years ago
The DNA segment that carries information for building one protein or polypeptide chain is called a(n) ________.
kirill115 [55]

Answer:

The correct answer is a gene

Explanation:

The DNA segment that carries information for coding one protein or polypeptide is called a gene. According to one gene-one polypeptide hypothesis, each gene is responsible for making a single chain of the polypeptide.

Originally it was said that one gene codes for one enzyme but later it was found that some gene also codes for non-enzyme proteins and single polypeptide chains. So after this research, the theory was modified and one gene-one polypeptide theory came. Therefore the right answer is gene.

8 0
3 years ago
Other questions:
  • Strep throat how long after antibiotics feel better
    8·1 answer
  • The miller and urey abiotic synthesis experiment (and subsequent, similar experiments) showed that __________.
    15·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of the following is an example of genetic engineering? I need an answer PLZ due today
    13·2 answers
  • Along with plants and algae, in which organisms can photosynthesis occur?
    13·2 answers
  • Through the semester, you have used two bacteria that produce colorful colonies: one produce yellow colonies, another one pink.
    7·1 answer
  • What are differences about Early earth and Modern earth?
    15·1 answer
  • PLEASE HELP FAST!! IM ON A TIMER
    7·1 answer
  • How do humans interact with the atmosphere?
    5·2 answers
  • Global Energy
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!