1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aksik [14]
3 years ago
13

1. All genes are not "on" all the time. Using the metabolic needs of E. coli, explain why not. 2. What are the two main ways of

controlling metabolism in bacterial cells? 3. Feedback inhibition is a recurring mechanism throughout biological systems. In the case of E. coli regulating tryptophan synthesis, is it positive or negative inhibition? Explain your choice. 4. What is a promoter? 5. What is the operator? What does it do? 6. What is an operon?
Biology
1 answer:
Katen [24]3 years ago
7 0

Answer:

Explanation:

1. All genes are not 'on' all the time. Using the metabolic needs of <em>E.coli, E.coli</em> regulate their gene expression to reserve resources when the environment is giving them what they need. <em>E.coli </em>feed on tryptophan, they produce it when tryptophan is low in the environment and they stop the production when it is abundant in their environment.

2. The two main ways of controlling metabolism in bacterial cells include;

  • to adjust the activity of present enzymes
  • to adjust production level of an enzyme

3. <em>E.coli</em> is negative inhibition because it involves an operon being switched off by active form of repression protein.

4. A promoter is a site where RNA polymerase can bind to DNA and begin transcription

5. The operator is the 'on switch' for gene replication. it is positioned within the promoter or between the promoter and enzyme coding genes. it controls the access of RNA polymerase to the genes.

6. An operon is the functioning unit of DNA containing a cluster of genes under the control of a single promoter.

You might be interested in
Limate warming trends allow plant and insect species to inhabit larger ranges.
solniwko [45]
This is true. when it is warmer the planet and insects can migrate to thses other places so they do not have to die or hibernate through winter.
8 0
2 years ago
The rising of bread dough is the result of The rising of bread dough is the result of oxygen being released. carbon dioxide prod
Luba_88 [7]

Answer:

Fermentation

Explanation:

Fermentation is the process whereby carbohydrates are converted to acohol or acid by the activities of some enzymes. During the process of fermentation, carbon dioxide is produced and it is found as tiny pockets of air inside the bread dough. This make it to rise. The alcohol produced evaporates later during the bread making process.

5 0
2 years ago
What elements that have atoms with full outer shells of electrons?
vladimir2022 [97]
Elements that  have atoms with full outer shells of electrons 
Are inert

7 0
2 years ago
How many covalent bonds can a typical carbon atom form?
Sedaia [141]

Hey! I'm pretty sure this is chemistry instead of biology haha

But anyways, a typical carbon atom can form up to 4 covalent bonds!

5 0
3 years ago
Read 2 more answers
Which device is designed specifically to support and immobilize a body part in a desired position?
tensa zangetsu [6.8K]
The device is called a splint
3 0
3 years ago
Other questions:
  • Also in lizards, color is controlled by a different gene. There are two alleles that are incompletely dominant to each other. Th
    12·2 answers
  • Which of the following are threadlike linear strands of DNA and proteins that carry the genes and functions in the transmission
    6·2 answers
  • Which of these is a compound?
    12·1 answer
  • In which of the following situations is a plant reproducing sexually? A. A potato plant produces a tuber, and the next year, a n
    15·2 answers
  • During chilly days, you might notice lizards lying (“basking”) in sunny areas. Why do lizards bask in the sun?
    6·1 answer
  • River systems on the western side of the rocky mountains flow into the pacific ocean/ river systems on the eastern side of the r
    10·1 answer
  • In December, Bill was driving through Florida with his family. As they drove closer to the coast, Bill noticed that the air grew
    6·1 answer
  • Explain how the human body is a system.
    14·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • so my grandfather wanted brownies since the cheesecake was gone... they are currently making... I told them that they are lucky
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!