Answer:
The answer is positive interference
Explanation:
Answer: Kinetic Energy
Explanation:
Kinetic Energy is energy in motion, while Potential Energy is stored.
Cytokinesis is part of M-phase, but not part of Mitosis. M-phase consists of nuclear division (mitosis) and cytoplasmic division (cytokinesis). And yes, telophase is part of mitosis, so it's in M-phase <span>too.
I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!
</span>
The burn of calories is connected to gender, mass and the age. These characteristics are the similar for both individuals, so you have to look for the outcome of the body fat percentage.
Muscles are an active tissue which suggests that at rest they burn calories in a bigger proportion than fat. So, the male with more muscles will likely burn more calories at rest.
The lower the fat percentage the higher the muscle percentage.
To conclude, that the male with 13% of body fat will burn more calories at rest than the male with 29% of body fat.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.