1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xxMikexx [17]
3 years ago
11

How does photosynthesis yield sugar? sumarize how the light-capturing reactions a?

Biology
1 answer:
julsineya [31]3 years ago
6 0
Answer
            Photosynthesis yield sugar in two main steps

1. Light reaction
                           
In this step plant absorb sunlight which cause photolysis of water and excitation of electron. this electron flow through Z-scheme and atlast enter into NADH,  the end product of light reaction is ATP and NADH₂.

2. DArk reaction.
In this step ATP and NADH₂ are used as raw materials. it occurs in stroma of chloroplast. here CO₂ is used through Calvin cycle and at the end glucose is prepared.

You might be interested in
When analyzing three genes that reside on the same chromosome, the expected frequency of double-crossover events can be determin
statuscvo [17]

Answer:

The answer is positive interference

Explanation:

8 0
3 years ago
When a person strikes and lights a match, potential energy in the match is transformed into which types of energy?
DanielleElmas [232]

Answer: Kinetic Energy

Explanation:

Kinetic Energy is energy in motion, while Potential Energy is stored.

5 0
2 years ago
Read 2 more answers
Is cytokinesis a part of mitosis ?
stich3 [128]
Cytokinesis is part of M-phase, but not part of Mitosis. M-phase consists of nuclear division (mitosis) and cytoplasmic division (cytokinesis). And yes, telophase is part of mitosis, so it's in M-phase <span>too.

I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!
</span>
5 0
2 years ago
Two males weigh 195 pounds and are 45 years old. one has a body fat percentage of 13% and the other's body fat percentage is 29%
Komok [63]
The burn of calories is connected to gender, mass and the age. These characteristics are the similar for both individuals, so you have to look for the outcome of the body fat percentage.


Muscles are an active tissue which suggests that at rest they burn calories in a bigger proportion than fat. So, the male with more muscles will likely burn more calories at rest.


The lower the fat percentage the higher the muscle percentage.



To conclude, that the male with 13% of body fat will burn more calories at rest than the male with 29% of body fat.
6 0
3 years ago
Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
umka2103 [35]

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
6 0
2 years ago
Other questions:
  • Is a kangaroo multicellular
    14·2 answers
  • When an animal starts breaking down body fat to compensate for a caloric deficiency in its diet, ________ are released into the
    13·1 answer
  • . When psychologists say that a given trait is due more to nature than nurture, they mean that the trait
    12·1 answer
  • A reflex, like automatically removing your hand from a hot stove, involves pain messages sent to the spinal cord by way of _____
    11·2 answers
  • Gastric juice is produced by the stomach.<br><br> TrueFalse
    12·1 answer
  • 1.
    7·1 answer
  • What is An aquatic animal that makes protein based slime
    6·2 answers
  • How many<br> dependent<br> variables do you<br> want in an<br> experiment?
    12·2 answers
  • There is a great diversity of metabolism in microbes, with new types being discovered regularly. For example, the use of nanowir
    7·1 answer
  • How many genes to dihybrids compare?<br><br> 1<br> 4<br> 3<br> 2
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!