El mecanismo por el cual el calor se transfiere de un objeto a otro a través de colisiones de partículas se conoce como conducción. En conducción, no hay transferencia neta de material físico entre los objetos.
<span> A </span>test cross<span>, involves the breeding of an individual with a phenotypically recessive individual.
</span>
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
The answer would most likely be sodium because carbon is a plants food, phosphorus is a nutrient in soil, hydrogen is air, but sodium does not have a place in a plant:)
Answer: A. cooled and hardened lava from volcanoes
C. sediments deposited by rivers and ocean currents
An accretion is a process in which new materials are added to a tectonic plate or landmass. This process causes the enlargement of the landmass. The materials being added includes sediments, lava from volcanic eruptions and other materials from other sources.
The process of accretion can enlarge the size of a continent along its edge. The new land comes from the cooled and hardened lava from volcanoes and other reason is sediments deposited by rivers and ocean currents.
