1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Debora [2.8K]
3 years ago
13

The process of accretion can enlarge the size of a continent along its edge. Where does the new land come from?

Biology
2 answers:
lozanna [386]3 years ago
8 0

Answer:

Fragments of crust colliding with the continental plate

Explanation:

Its just right bro

photoshop1234 [79]3 years ago
4 0

Answer: A. cooled and hardened lava from volcanoes

C. sediments deposited by rivers and ocean currents

An accretion is a process in which new materials are added to a tectonic plate or landmass. This process causes the enlargement of the landmass. The materials being added includes sediments, lava from volcanic eruptions and other materials from other sources.  

The process of accretion can enlarge the size of a continent along its edge. The new land comes from the cooled and hardened lava from volcanoes and other reason is sediments deposited by rivers and ocean currents.  


You might be interested in
What is the function of a muscle cell?
Brut [27]
Producing a contraction that changes both the length and the shape of the cell
4 0
3 years ago
Which objects allow humans to access groundwater? Check all that apply.
Masja [62]
<h2>Answer:</h2>

<u>The objects that allow humans to access ground water are:</u>

  • <u>A spring</u>
  • <u>a well drilled into an aquifer </u>
  • <u>a well drilled below the water table</u>
<h2>Explanation:</h2>

Access to ground water can be gained if we dig a well or use any source that can provide us an access below the water table. A water table is the level below which the ground is saturated with water. So above the saturation level we cannot gain access to water therefore we must go below it. A spring springs from ground below water table and the same thing occurs for well or an aquifer if it is below the water table..

8 0
3 years ago
Read 2 more answers
The _______is a large, heavy bird that is rarely seen out of water.
BARSIC [14]

Answer:

hawk prolly

Explanation:

3 0
2 years ago
HELP !!!! When adenine pairs with thymine how many hydrogen bonds are formed?
Assoli18 [71]

two hydrogen bonds are formed between adenine and thymine

8 0
3 years ago
Can anyone help me please
Natalka [10]

Answer:

hehe thanks

Explanation:

7 0
2 years ago
Other questions:
  • When plants absorb and incorporate nitrogen into the soil it is called
    11·1 answer
  • According to the endosymbiotic theory, which cellular process was involved in the evolution of mitochondria and chloroplasts?
    10·2 answers
  • Which is an example of a technological factor influencing food choices?
    14·1 answer
  • 22 points
    15·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which level contains the herbivores
    14·1 answer
  • Using complete sentences, answer the questions below. please help!
    9·1 answer
  • What si the answer ? Somebody pls smart peopdn
    5·1 answer
  • Which of the following is NOT a difference between RNA and DNA molecules? *
    14·1 answer
  • Photosynthesis takes place in two separate but dependent series of steps:
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!