1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
asambeis [7]
3 years ago
7

Which biome, typical of Africa, is home to many grazing animals? A) desert B) savanna C) taiga D) tundra

Biology
1 answer:
Maurinko [17]3 years ago
8 0
Answer is b (: I hope this helps
You might be interested in
What was new york cities water pollution in parts per million 50 years ago
Katyanochek1 [597]

Answer:

625 ppm 50 years ago

Explanation:

7 0
2 years ago
Why can many ecosystems exist in one biome
ryzh [129]
The definition of a biome is the community of many ecosystems in one general area. Many ecosystems can exist in a biome because a biome could have a water ecosystem and a dirt ecosystem.
6 0
3 years ago
A __________ is the juvenile form of a coral polyp.
julsineya [31]
4) Larva
Coral reproduce both sexually and asexually. The offspring produces sexually may be referred to as larvae and are the juvenile form of coral.
5 0
3 years ago
Read 2 more answers
Which term best describes the interval between the birth of the newborn and the return of the reproductive organs to their norma
kodGreya [7K]

Answer:

B. Puerperium, or fourth trimester of pregnancy

Explanation:

  • Puerperium or the fourth trimester of pregnancy is also known as the postpartum period.
  • This period starts immediately after the mother gives birth to a child.
  • During this period the size of the uterus and other reproductive organs along with the hormone levels return to their normal state.
  • It is the phase where regression of all the anatomical and physiological changes that took place i in the reproductive organs of the females takes place.
  • This phase is divided int three periods -

1. Immediate puerperium, or the first 24 hours after parturition

2. Early puerperium, which extends until the first week postpartum;

3. Remote puerperium, which includes the period required for involution of the genital organs and return of menses, usually approximately 6 weeks.

  • This phase is highly critical for the mother as this requires rest and proper care as there are risks of bleeding. Therefore, the midwife or the nurse must take proper care of the mother.
8 0
2 years ago
Which statement is an example of a feedback mechanism in humans
ExtremeBDS [4]

Answer:

1.

Explanation:

Controlling the level of sugar in the blood is an example of a feedback mechanism

8 0
2 years ago
Other questions:
  • The human respiratory system consists of many different cells, tissues, organs, and organ systems. explain the relationships bet
    8·1 answer
  • Which statement best describes cancer cells?
    12·2 answers
  • What type of bond is found between the hydrogen and oxygen in the water molecule? Describe this bond
    10·1 answer
  • What do scientists need to look at before developing an argument
    13·2 answers
  • This microwave is heating up a cup of hot cocoa. The microwave uses what type of thermal energy transfer? Question 19 options: c
    11·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Are girls born with the pregnancy hormone?
    11·1 answer
  • Which of these processes describes the effect Earth's atmosphere has on Earth's hydrosphere?
    5·2 answers
  • what term refers to a situation where a single phenotypic character is determined by the additive effects of two or more genes?
    7·1 answer
  • Drag each item to the correct location on the table.
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!