Fibrous roots grow from the main stem of the plant and does not have a primary root like the taproot. They grow downward and outward, with repeating branches to form a mass of small roots.Dicots and monocots are the two classes of flowering plants. The majority of taproot systems are composed of dicots and conifers.
Groundwater is recharged naturally by rain and snow melt , hope this helps :)
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
Mutation, Gene flow/Migration/Immigration of gene and Recombination
Explanation:
For any species there are majorly three sources of genetic variations –
a) Mutation – This leads to change in the genetic code with in the DNA of an organism. Sometimes mutation does not produce any effect on the organism. Mutation can produce both positive and negative impact. Its effect is observed in long run as its rate is slow.
b) Recombination – When an organism undergoes sex, his/her genes recombine with the genes of mating partner. The rate of recombination is faster than the rate of mutation
c) Gene flow /Migration/Immigration of gene – In this gene travel from one set of population to the other. The frequency of gene in the mixed population lies between the original population gene frequency and the migrated or donor population gene frequency