1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
myrzilka [38]
3 years ago
11

Do autotrophs need to carry out cellular respiration? Why or why not?

Biology
1 answer:
AfilCa [17]3 years ago
7 0
While photosynthesis requires carbon dioxide and releases oxygen, cellular respirationrequires oxygen and releases carbon dioxide. It is the released oxygen that is used by us and most other organisms for cellular respiration. We breathe in that oxygen, which is carried through our blood to all our cells.
You might be interested in
What types of materials require a vesicle for export or a food vacuole for import?
Korvikt [17]

Macromolecules or large particles are carried across the cell membrane via vesicles or other intracellular structures. Pinocytosis and efflux are the two types of vesicle transport.

<h3>How does a vesicle leave the cell with its cargo?</h3>

Exocytosis is the process by which cells move components from within the cell to the extracellular fluid. Exocytosis occurs when a vesicle's plasma membrane fuses with it, expelling its contents outside the cell.

The Golgi, also known as the Golgi complex, is a flattening, layered organelle that looks like a stack of pancakes. The Golgi body modifies and packages proteins and carbohydrates into lattice vesicles for "exportation" from the cell.

learn more about  vesicle transport. refer

brainly.com/question/4919705

#SPJ4

6 0
1 year ago
HELP ME PLS I DONT UNDERSTAND :( WILL GIVE BRAINLIEST 2 QUESTIONS
Serhud [2]

Answer:

1. D, because plants are the main producers

2. B, because the wind direction makes Seattle coo and dry, and the mountain block some of the wind for Spokane

Explanation:

5 0
3 years ago
What is a difference between prokaryotic and eukaryotic cells?
GenaCL600 [577]

Answer:

<em><u>Eukaryotic cells</u></em> contain membrane-bound organelles, such as the nucleus, while <em><u>prokaryotic cells</u></em> do not. Differences in cellular structure of prokaryotes and eukaryotes include the presence of mitochondria and chloroplasts, the cell wall, and the structure of chromosomal DNA.

4 0
3 years ago
Read 2 more answers
24) Adult behavior is often influenced by their family and cultural experiences during childhood. Julia is a young adult that gr
Butoxors [25]

Even with a good diet, a sedentary lifestyle can cause damage to our health, so to answer the question we need to understand that.....

<h3>Choose healthy habits</h3>

Nothing better than starting with an essential tip. So it's time to forget the bad habits that only bring harm and choose healthy habits.

It is well known that habits in general are part of 40% of our day. That's right! We spend almost half of our time doing daily chores without realizing it and with autopilot on.

So it's these established ideas that can become harmful in the long run. And our unconscious is responsible for them. With this, it is important to make healthy choices to replace old harmful habits.

With this information, we came to the conclusion that the habit of exercising brings health benefits, even when the person has a good diet.

Learn more about Health in brainly.com/question/13179079?referrer=searchResults

5 0
2 years ago
What problems could arise if the protein is not formed correctly
Lady bird [3.3K]
This would mean a change in base sequence, which is very important for the proteins to carry out their function. It could lead to a mutation and a change in the role of the protein.
8 0
3 years ago
Other questions:
  • Chromosomes are distributed equally to daughter cells. Interphase or mitosis
    7·1 answer
  • Why are sex-linked traits more common in males than in females?
    11·1 answer
  • How do a cat’s teeth help the cat catch mice? A) Cats’ teeth are large and help the cat catch large animals. B) Cats’ teeth are
    6·2 answers
  • Variation within organisms in a species increases the chance that a species will survive changing conditions. What kind of repro
    8·1 answer
  • The buildup of pesticides in an organism as you move up the food chain is called
    9·1 answer
  • What is the history of Galápagos Islands? I need help!
    13·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Some rocks are formed from _______ that erupts from volcanoes as lava.
    15·1 answer
  • Which of the following are techniques besides molecular clocks used by scientist to calculate the rate at which a stretch of DNA
    13·1 answer
  • Which of the following is an example of deductive reasoning?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!