All categories

3 years ago

A variable-ratio schedule reinforces behavior after a:

1 answer:

8 0

A reinforcement schedule is a pattern that defines how often a desired response will be reinforced.<span>
</span>A variable-ratio schedule <span>is a schedule of reinforcement where a response is reinforced after an unpredictable number of responses.</span>
<span>Fixed-interval schedules on the other hand reinforce behaviors after set time periods.</span>

You might be interested in

What is active transport?

Igoryamba

Answer:

Transportation of substances in cells, where they travel against the concentration gradient. However, it requires ATP to do so.

Explanation:

7 0

3 years ago

Which of the following is an example of a population?

sesenic [268]

Answer:

The correct answer will be option-A

Explanation:

The ecological population is the group of the organism belonging to the same species which live or is found in the particular area and can interbreed.

Since in the given question, the redwood trees live in the same geographical area (forest) which can interbreed shows the population. The other examples represent the community which consists of more than one species.

Thus, option-A is the correct answer.

3 0

3 years ago

Which affect is one likely result of a forest fire

Luda [366]

One affect could be a loss of habitat for the animals that lived in that forest

6 0

3 years ago

Read 2 more answers

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

When it comes to identifying the process that form rocks, the present is the key to the

Strike441 [17]

Rocks are identified primarily by the minerals they contain and by their texture. Each type of rock has a distinctive set of minerals. A rock may be made of grains of all one mineral type, such as quartzite. Much more commonly, rocks are made of a mixture of different minerals. Texture is a description of the size, shape, and arrangement of mineral grains. Are the two samples in figure 2 the same rock type? Do they have the same minerals? The same texture?

Explanation:

8 0

3 years ago