1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lisabon 2012 [21]
3 years ago
12

What is the significance of dysplasia seen in a Pap smear?

Biology
1 answer:
raketka [301]3 years ago
6 0
The malignant one. Abnormal growth of endometrial tissue could be a sign of cancer.
You might be interested in
Darwin was offered a position on the _________________ whose mission was to survey the waters around South America.
Arte-miy333 [17]

The correct answer is the ship beagle I think I spelled that right

6 0
3 years ago
Which of the following is the correct definition of a wave? A disturbance that transfers energy from one place to another ocean
lys-0071 [83]
The first one; a disturbance that transfers energy from one place to another
4 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
2. Describe the different ways that a system can be efficient. For example, time
Snezhnost [94]

What Is Economic Efficiency?

Economic efficiency is when all goods and factors of production in an economy are distributed or allocated to their most valuable uses and waste is eliminated or minimized.

KEY TAKEAWAYS

Economic efficiency is when every scarce resource in an economy is used and distributed among producers and consumers in a way that produces the most economic output and benefit to consumers.

Economic efficiency can involve efficient production decisions within firms and industries, efficient consumption decisions by individual consumers, and efficient distribution of consumer and producer goods across individual consumers and firms.

Pareto efficiency is when every economic good is optimally allocated across production and consumption so that no change to the arrangement can be made to make anyone better off without making someone else worse off.

1:17

Economic Efficiency

Understanding Economic Efficiency

Economic efficiency implies an economic state in which every resource is optimally allocated to serve each individual or entity in the best way while minimizing waste and inefficiency. When an economy is economically efficient, any changes made to assist one entity would harm another. In terms of production, goods are produced at their lowest possible cost, as are the variable inputs of production.

Some terms that encompass phases of economic efficiency include allocative efficiency, productive efficiency, distributive efficiency, and Pareto efficiency. A state of economic efficiency is essentially theoretical; a limit that can be approached but never reached. Instead, economists look at the amount of loss, referred to as waste, between pure efficiency and reality to see how efficiently an economy functions.

Economic Efficiency and Scarcity

The principles of economic efficiency are based on the concept that resources are scarce. Therefore, there are not sufficient resources to ensure that all aspects of an economy function at their highest capacity at all times. Instead, scarce resources must be distributed to meet the needs of the economy in an ideal way while also limiting the amount of waste produced. The ideal state is related to the welfare of the population with peak efficiency also resulting in the highest level of welfare possible based on the resources available.

Efficiency in Production, Allocation, and Distribution

Productive firms seek to maximize their profits by bringing in the most revenue while minimizing costs. To do this, they choose the combination of inputs that minimize their costs while producing as much output as possible. By doing so, they operate efficiently; when all firms in the economy do so, it is known as productive efficiency.

Consumers, likewise, seek to maximize their well-being by consuming combinations of final consumer goods that produce the highest total satisfaction of their wants and needs at the lowest cost to them. The resulting consumer demand guides productive (through the laws of supply and demand) firms to produce the right quantities of consumer goods in the economy that will provide the highest consumer satisfaction relative to the costs of inputs. When economic resources are allocated across different firms and industries (each following the principle of productive efficiency) in a way that produces the right quantities of final consumer goods, this is called allocative efficiency.

Finally, because each individual values goods differently and according to the law of diminishing marginal utility, the distribution of final consumer goods in an economy are efficient or inefficient. Distributive efficiency is when the consumer goods in an economy are distributed so that each unit is consumed by the individual who values that unit most highly compared to all other individuals. Note that this type of efficiency assumes that the amount of value that individuals place on economic goods can be quantified and compared across individuals.

Economic Efficiency and Welfare

Measuring economic efficiency is often subjective, relying on assumptions about the social good, or welfare, created and how well that serves consumers. In this regard, welfare relates to the standard of living and relative comfort experienced by people within the economy. At peak economic efficiency (when the economy is at productive and allocative efficiency), the welfare of one cannot be improved without subsequently lowering the welfare of another. This point is called Pareto efficiency

4 0
2 years ago
Cuantos huesos pares tiene el craneo
MArishka [77]

Answer:

Human skulls have 22 bones: 8 cranial bones and 14 facial bones, according to the National Center for Biotechnology Information (NCBI).

Explanation:

please mark this answer as brainlest

7 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following statements about the intensity of a nerve response is true?
    9·2 answers
  • What effect might an earthquake along this fault have on a river that runs perpendicular to the fault
    11·2 answers
  • What enzyme found in saliva breaks chemical bonds between the sugar monomers in starches
    10·2 answers
  • Atomic mass is determined by the number of protons plus the number of _____.
    15·1 answer
  • According to cell theory, which of the following are made of cells? Check all that apply.
    15·2 answers
  • Which of these is returned to the atmosphere when plants transpire?
    6·1 answer
  • Which term refers to the organism eaten by a predator
    7·1 answer
  • Type A– blood. Which blood type could she receive in a blood transfusion?
    9·2 answers
  • Sex-linked traits are more common in males than females because they are carried on the X chromosome and Y does not carry these
    15·1 answer
  • Which of the following is true about protein molecules?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!