1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexgriva [62]
3 years ago
6

Will give Brainliest answer

Biology
1 answer:
Wewaii [24]3 years ago
6 0

Answer:

Nitrogen is converted from atmospheric nitrogen (N2) into usable forms, such as NO2-, in a process known as fixation. ... This occurs in two steps: first, bacteria convert ammonia in to (nitrites) NO2-, and then other bacteria species convert it to NO3- (nitrate). Nitriates are a form of nitrogen that is usable by plants.

Explanation:

You might be interested in
What are similar structures that evolved independently called?
Ilia_Sergeevich [38]

Answer:

Analogous structures

Explanation:

These structures are similar but not derived from the common ancestor like homologous structures. Analogous structures are formed as a result of convergent evolution-type of evolution in which organisms develop on similar way but independently. An example of analogous structures are wings. Birds, insects and bats all have wings, with the same purpose (flight) but they evolved in their own way.

4 0
3 years ago
The nurse is considering risk factors for influenza in a group of preschool children. which factors are considered to place chil
Serggg [28]
There were no choices provided. But there is a related research about this situation. 

Risk factors of influenza transmission in households
Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1326070/

<span>>Reasons for increased transmission from children
</span>  The research pointed three causes. 
   1. Children are more exposed to different people in different places. their households, peers in schools and other children.

   2. Children especially preschools are said to have lower immunity which makes them prone and catching influenza.

   3.  Lastly, viral shedding among children can alleviate and spread period of infection.
4 0
3 years ago
What observation proves that a cell is a prokaryote
nevsk [136]
If it doesnt have a nucleus or a cell wall it is a prokaryote. also prokaryotes displayed in pictures tends to be longer
3 0
3 years ago
which type of cell division (mitosis v meiosis) increases the likelihood of variation with a species? explain how it happens?
kipiarov [429]
Meiosis Bc it is genetic variation and ends with 4 cells with a completely different genetic make up whole mitosis is the cell division of identical cells. It ends with two daughter cells.
5 0
3 years ago
To which group does the pine true?
pshichka [43]

Answer:

Pine trees are conifers!

Explanation:

Your question was a bit confusing but I'm assuming you are asking which group does pine trees belong to. Hope this helps!

5 0
3 years ago
Read 2 more answers
Other questions:
  • The spontaneous emission of radiation by an unstable atomic nucleud is called?
    7·1 answer
  • What is the third codon in the mRNA you produced in
    6·1 answer
  • 12. The proteins and lipids, essential for building the cell membrane, are
    11·1 answer
  • Which of the following animals does not lay eggs? Spiny anteater Robin Leopard Frog
    15·2 answers
  • How does a light microscope work​
    6·1 answer
  • Brown eyes in humans is a dominant trait. we inherit dominant traits from our parents, some from our mother and some from our fa
    8·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • 10. Which of these statements is correct about the circulatory system?
    13·1 answer
  • Is a proton positive or negative or electron
    6·2 answers
  • Image attached…………………..
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!