1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
musickatia [10]
3 years ago
10

Texas bluebonnet plants seen in this photo are an example of which

Biology
1 answer:
likoan [24]3 years ago
3 0

Answer:

<em>The correct option is C) A species</em>

Explanation:

A species can be described as a group of living organisms that are able to live together and can produce fertile offsprings. For example, Texas bluebonnet plants are a species of plants which will interbreed and produce fertile offsprings.

Other options like option D are not correct because a community consists of different species  which live and interact with one another at a particular time in a particular area. The different species cannot interbreed. For example, a community consisting of Texas bluebonnet plants, other trees, grasshoppers etc.

You might be interested in
If one concentration of a sugar solution is lower outside the cell than inside the cell which will happen by osmosis?
timurjin [86]

C) Water will move into the cell.

8 0
3 years ago
What organelles can only be found in animal cells?
SOVA2 [1]
The lysosomes are the “garbage disposal” of animal cells , the same process takes place in plant cells in its vacuoles
5 0
3 years ago
When new dna molecules are formed, almost all errors are detected and fixed by:.
Juli2301 [7.4K]
DNA polymerase .



Have a good day or night:)
6 0
1 year ago
Movement of food from the stomach into the esophagus is usually prevented by
gavmur [86]
The movement of food from the stomach into the esophagus is usually prevent by the sphincter
5 0
3 years ago
How does glycolysis work
natita [175]
Alright hopefully this isn't to confusing but, Glycolysis is the first step in the breakdown of glucose to extract energy for cellular metabolism. Also most living organisms carry out "glycolysis" as part of their metabolism. Last but not least, the process doesn't even use oxygen it takes place in anaerobic conditions.
4 0
3 years ago
Other questions:
  • What type of investigation to plant height if the amount of available light is reduced due to global dimming
    11·1 answer
  • Suppose a bug eats a plant. Then a frog eats the bug. Does the frog gain the same amount of energy from eating the bug that the
    8·1 answer
  • A student is studying the amino acid sequence of a protein shared by four organisms. The student wants to know which organism is
    11·1 answer
  • In any food web, plants are considered to be producers. They convert sunlight (solar energy) into usable chemical energy (glucos
    15·1 answer
  • What would a control be for an experiment to see whether fertilizer helps a plant to grow?
    8·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • HURRY ILL MARK AS BRAINLIEST!
    11·1 answer
  • PLEASEEE FASTTTT I HAVE A TEST NOW!
    15·1 answer
  • How many significant digits are in the measurement below?
    13·1 answer
  • In unit 4, you learned about the executive branch. First, identify which executive branch and bureaucratic agencies might be inv
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!