1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnesinka [82]
3 years ago
14

Muscular dystrophy can result in loss of mobility and lack of coordinated movements. Given this information, what does mu

Biology
2 answers:
STatiana [176]3 years ago
7 0

Answer:

Muscle tissue from communicating with the brain

Explanation:

Muscular dystrophy is the term used to describe a group composed of more than 30 diseases that directly affect the muscular system. These diseases are of a genetic nature and are directly linked to the X chromosome. As already mentioned, this group of diseases causes damage to the muscles and their progressive degeneration, in addition to their malfunction, because it prevents muscle tissue from communicating with the brain. .

These diseases are commonly present in men, although women are asymptomatic carriers of the defective gene responsible for the disease.

expeople1 [14]3 years ago
6 0

Answer:

Muscle tissue from communicating with the brain

Explanation:

You might be interested in
Which is a disadvantage of using wind energy and solar energy as renewable resources instead of using nonrenewable resources, su
torisob [31]

Answer:

wind and solar energy rely on weather to generate power unlike fossil fuels

8 0
3 years ago
NaHC3 is an example of what
maksim [4K]

Answer: sodium bicarbonate

3 0
3 years ago
Read 2 more answers
Help science!
Elza [17]
The answer is C........
4 0
4 years ago
Question 9 (1 point)
bogdanovich [222]

Answer:

No sunlight penetrates the Abyssal zone.

Explanation:

I did this on my study guide a while back and got an A for it.

3 0
3 years ago
Molecules are held together by chemical bonds which are basically the energy relationships between atoms.
galina1969 [7]
This is due to the intermolucular force of attraction which is strong enough to hrld in the chemical bonds
8 0
3 years ago
Other questions:
  • At times this photosynthetic organism can switch to being heterotrophic. Describe a condition that would favor this organism bei
    12·2 answers
  • Which mineral identification property looks at how a mineral splits along geometric planes determined by its crystal structure?
    10·2 answers
  • Darwin hypothesized that new species could appear gradually through small changes in an ancestral species. What experiment did h
    8·2 answers
  • Blood types are determined by the presence of protein located on
    10·1 answer
  • Refer to the following practices:
    7·1 answer
  • In a step by step format, write about the process of the blood flow as it enters the heart until it leaves the heart. It should
    8·2 answers
  • Which of the following terms best characterizes catabolite repression associated with the lac operon in E. coli? Which of the fo
    13·1 answer
  • Where does the charge on a protein come from?
    9·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Give 10 scientific differences between male and female ​
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!