1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
STALIN [3.7K]
3 years ago
11

The very structured cells may viewed with a light compound microscope.

Biology
1 answer:
irakobra [83]3 years ago
5 0

Answer:

These cells are Eukaryotic and are autotrophic

Explanation:

These are the cells of onion. An oinion is a plant and because it is a plant it is autotrophic meaning they make their own food. Also plants are eukaryotic which means they have a nucleus.

You might be interested in
What is the elevation of the X on the topographic map shown below
Julli [10]

Answer:

answer is a 1325 ft

Explanation:

you have to estimate the numbers its rising by 50

so 1200ft first line second Line would be 1250ft and third line is 1300ft.

X is between 1300ft and 1350ft

5 0
3 years ago
What is Potometer?????
Soloha48 [4]
An instrument used for measuring rate of Transpiration occurring from lower surface of leaf.
6 0
3 years ago
DNA fragments form during DNA replication due to the discontinuous nature of replication on the lagging strand. DNA fragments ca
asambeis [7]

DNA polymerase

Explanation:

I did it on USAtest prep

6 0
3 years ago
Why was the cow insulin an effective substitute for the human insulin?
Ray Of Light [21]
Pork and beef insulins are similar to human insulin, differing only in one or a few amino acids. However, even a slight difference is enough to elicit an allergic response in some people. To overcome this problem, researchers looked for ways to make insulin that would more closely resemble human insulin.
6 0
3 years ago
Read 2 more answers
Pulling away from a painful stimulus is an example of a(n) ________ reflex.
NNADVOKAT [17]
It is an example of a withdrawal reflex.
7 0
3 years ago
Other questions:
  • Hi i like this app is so cool
    9·1 answer
  • HURRY In which step of meiosis do chromosomes first condense?
    10·2 answers
  • Why are organelles important to plants
    6·2 answers
  • If 2 heterozygous parents produce offspring, what is the probability that the offspring will also be heterozygous?
    7·1 answer
  • The leading cause of death and disability in the united states is ________.
    15·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What are the importance of planting and propagating trees and fruit bearing trees?​
    12·2 answers
  • Which of the following statements is true?
    9·1 answer
  • Explain why plants with normal leaves grow more than plants with variegated leaves.
    6·2 answers
  • Which of these is another name for the
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!