1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ruslelena [56]
3 years ago
12

In many areas of the world, food shortages are common. To improve crop growth, what should be done to help acidic soil

Biology
1 answer:
ad-work [718]3 years ago
8 0
In acid soils you can select the crops that can growth in this conditions (pH 6.0 - 6.5 is slightly acidic, and you can find cultures that can be cropped under this conditions). If soil is acid to highly acidic , in some areas of Northern Spain the use to increase the pH by liming the soil in a gradual / gentle way. You can find different product for liming fron rocks, wastes (from marble industries; animal bones; etc
You might be interested in
The Honeydough Bread factory produces 2,000 loaves of bread per day.
Tasya [4]

Alcoholic fermentation; carbon dioxide. Alcoholic fermentation produces alcohol and carbon dioxide in bread. The alcohol evaporates during the baking process.



8 0
3 years ago
Hello everyone<br> Free Bio Class<br> Interested<br> Students<br> Can join<br> mwq-bmxj-sym
damaskus [11]

Thanks for telling........

3 0
3 years ago
Read 2 more answers
Which of the following statements about cell organelles is NOT true?
Anton [14]

Answer:

B

Explanation:

many of the same organelles are located in both plants and animals cells

4 0
2 years ago
Why is the best definition of directional selection
Anna35 [415]

Answer: Directional selection occurs when individuals with traits on one side of the mean in their population survive better or reproduce more than those on the other. ... Directional selection does the “heavy lifting” of evolution by tending to move the trait mean toward the optimum for the environment.

7 0
3 years ago
Read 2 more answers
Can someone please help asap
balu736 [363]
It would be lithium and nickel due to the electrons
5 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • A bowhunter's quarry is antelope, deer, black bear, or other big game of similar size or smaller. Which shot offers a good chanc
    9·2 answers
  • What abiotic and biotic factors characterize biones?
    13·1 answer
  • Why does the oxygen atom in a water molecule have a negative charge?
    5·1 answer
  • Contrast the reproduction of bacteria with that of frogs
    12·1 answer
  • Why are bacteria necessary for the nitrogen cycle to take place?
    10·1 answer
  • What is the process that produces haploid (1n) cells is known as?
    6·2 answers
  • Which statement about freshwater resources in the region is accurate? (please help)
    9·1 answer
  • what is the best synonym for hormone A. Bodily organ B. bodily tissue C. Blood cell D. Chemical Messenger
    5·2 answers
  • Examine the results of an experiment above discussing how temperature affects cellular respiration.
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!