1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
11111nata11111 [884]
4 years ago
10

How much mass does 0.1 mole of neon contain? A) 26.018 g B) 2.02 g C) 2.0 g D) 2 g

Chemistry
2 answers:
nignag [31]4 years ago
7 0
2 grams is the answer

Naddika [18.5K]4 years ago
4 0

D) 2 g is the answer.

You might be interested in
Consider this reaction: NH4+ + HPO42− → NH3 + H2PO4−
a_sh-v [17]
Bronsted Lowry Acids are donates protons
Therefor it is <span>NH4+</span>
6 0
3 years ago
Read 2 more answers
How do you balance this?
ad-work [718]
Weigh them both and there you go
8 0
3 years ago
AACGTACGATCGATGCACATGCATGGCTACGC
Pachacha [2.7K]

Explanation:

if u have biology A=T and G=C

id.k what ur question is supposed to mean..

7 0
3 years ago
Read 2 more answers
A sample of gas occupies a volume of 50.0 milliliters in a cylinder with a movable piston. The pressure of the sample is 0.90 at
alina1380 [7]
P₁ = 0.90 atm

V₁ = 50.0 mL

T₁ = 298 K

P₂ = 1 atm

T₂ = 273 K

V₂ = P₁ x V₁ x T₂ /  T₁ x P₂

V₂ = 0.90 x 50.0 x 273 / 298 x 1

V₂ = 12285 / 298

V₂ = 41 mL

Answer (1)

hope this helps!
7 0
3 years ago
What’s the answer!?!!
EastWind [94]

Answer: generic material and protein coat. Have a great day

Explanation:

3 0
4 years ago
Other questions:
  • A reaction starts with 20.0 grams of lithium hydroxide (LiOH) and produces 31.0 grams of lithium chloride (LiCl), what is the pe
    8·1 answer
  • Mass is 5 grams and the volume is 4.5 grams what is the density
    12·1 answer
  • I will mark brainliest
    10·2 answers
  • The quantity of antimony in a sample can be determined by an oxidation–reduction titration with an oxidizing agent.
    8·2 answers
  • Which is lower in the food chain a mushroom or a tree
    8·2 answers
  • What are the components of DNA?
    15·1 answer
  • A gas has a pressure of 7.01 atm at 227°C. What will its temperature be if the pressure is increased to 12.1 atm and volume is h
    10·1 answer
  • Pls help will give brainlist
    6·1 answer
  • If a water fountain has an average flow rate of 0.64 gallons per minute, how many
    12·1 answer
  • Determine the oxidation numbers of all the elements in the unbalanced reactions. Then, balance each redox reaction in a basic so
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!