1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iVinArrow [24]
3 years ago
10

Which of the following conversion factors would you use to change 18 meters to kilometers?

Biology
1 answer:
Y_Kistochka [10]3 years ago
3 0
In converting a number with the unit of meter into kilometer we must use the conversion factor 1 km per 1000 meters.This is because in 1 kilometer there are 1000 meters and then the unit to be converted is already in meter so we need to divide it for us to convert.
You might be interested in
What happens when a person who is allergic to ragweed encounters ragweed?
slava [35]
Ragweed antigens bind ragweed and then bind mast cells which release histamine 

<span>Allergies develop because of a Th2 response against the allergen. </span>

5 0
4 years ago
One of the characteristics of life is to acquire energy. What is the energy used for?​
ANEK [815]

Answer:

All organisms use a source of energy for their metabolic activities. Some organisms capture energy from the sun and convert it into chemical energy in food (photosynthesis); others use chemical energy in molecules they take in as food (cellular respiration)Explanation:

poop

4 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Is anyone on here doing American Hone Schooling out of Lansing Illinois?
matrenka [14]
I'm not doing American Hone School. I'm busy with my own school
3 0
4 years ago
Read 2 more answers
Explain the importance of ATP at cellular level
Kryger [21]
The main role of ATP<span> is to provide energy

</span>energy released is used for metabolism in thecell<span>. Other reactions that require energy from </span>ATP<span> include; active transport/ muscle contraction/ glycolysis.</span>
8 0
3 years ago
Other questions:
  • Mr. Jamison is in the office complaining of back pain after moving and carrying heavy boxes. The practitioner suspects he has a
    7·1 answer
  • The nervpus system is made up of the central nervous system and the peripherial nervous system. true or false
    11·1 answer
  •  A complex of interconnected food chains in an ecosystem is called a/an 
    6·1 answer
  • Fred is studying his notes from anatomy class. One list in his notes describes features of a CNS structure.
    8·2 answers
  • Which of the following investigators was (were) responsible for the following discovery? In DNA from any species, the amount of
    15·1 answer
  • Short-term mechanisms for regulating blood pressure include regulating peripheral vascular resistance and cardiac output through
    9·1 answer
  • Hey! pls help i’ll give brainliest
    7·2 answers
  • Which of the following is NOT an example of a biotic factor in an ecosystem?
    10·1 answer
  • How is this drawing <br><br> rate this out of 100000
    8·1 answer
  • How is The environment on Mars different from that of Earth’s?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!