1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Olin [163]
3 years ago
7

Why are the core and mantle still so hot?Which layers of the earth are solid vs. liquid and why?

Biology
1 answer:
natka813 [3]3 years ago
4 0

The mantle and core of the earth are still hot because of the pressure of the overlying earth layers. The deeper the layer the hotter it is due to higher pressure, in lieu of the fact that temperature and directly proportional. In addition, some of the heat from the time the earth was formed is still trapped inside the earth and nuclear decay of radioactive elements in the regions ensure the earth does not cool.



The mantle and outer core of the earth are liquid while the inner core is solid. The former  layers are liquid because the temperatures in these regions have surpassed the melting point of the elements that make up the layers. However, the inner core remains solid due to the enormous pressure in the region. The pressure is so high it prevents the element in the region from melting.  


You might be interested in
Why must the bonds of these molecules be broken before anything else happens?
ser-zykov [4K]

Answer:

Synthesis releases energy because the molecules bond to form a stable configuration and therefore give up energy. The bonded molecules have a lower energy level than free molecules and are held in the new bond.

Explanation:

Chemical reactions make and break the chemical bonds between molecules, resulting in new materials as the products of the chemical reaction. Chemical reactions can occur spontaneously or require an outside trigger such as an input of energy. Breaking chemical bonds absorbs energy, while making new bonds releases energy, with the overall chemical reaction being endothermic or exothermic.

5 0
3 years ago
Which psychological concept did Pavlov's dog help him describe?
Nataly_w [17]

Answer: In his experiment, Pavlov used a metronome as his neutral stimulus. By itself the metronome did not elicit a response from the dogs. Next, <u>Pavlov began the conditioning procedure, whereby the clicking metronome was introduced just before he gave food to his dogs.</u>

Answer is A.

:)

3 0
3 years ago
Which best describes the reactions and products of photosynthesis?​
Nina [5.8K]

Answer:

Reactants are formed inside the plant, and products are taken in from the environment by the plant. Reactants are taken in from the environment by the plant, and products are formed inside the plant.

Explanation:

7 0
3 years ago
Easy one - giving brainly if correct​
Vlada [557]

Answer:

A seamount is a mountain that is formed at a hotspot, large enought to be seen above the ocean's surface

3 0
2 years ago
Read 2 more answers
List the levels of organization in a multicellular organism in order from simplest to most complex
g100num [7]
Atom
Molecule
Organelle
Cell
Tissue
Organ
Organ system
Organism
5 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What happens on the outer surface of a cell?
    8·1 answer
  • Identify the relationship between temperature and state change.
    12·1 answer
  • Compare the basic treatments for type 1 and type 2 diabetes
    9·2 answers
  • . The Vmax of a glucose transport into a certain preparation of red blood cells is determined to be 1206nmol glucose/s without A
    5·1 answer
  • Are wetlands and estuaries more similar or different? Defend your opinion.
    6·1 answer
  • Explain why cuboidal cells would not work as well as squamous cells in the alveoli of the lungs
    6·2 answers
  • Which of the following shows the correct order from most simple to most complex: atom, molecule, organelle, macromolecule molecu
    5·1 answer
  • Which observational tool helped astronomers Arno Penzias and Robert Wilson discover the existence of the cosmic microwave backgr
    8·1 answer
  • Genes are the parts of DNA that code for proteins.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!