1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DedPeter [7]
3 years ago
6

To which organelle does a C-terminal signal peptide sequence of the four amino acids KDELdirect peptides?

Biology
1 answer:
Fofino [41]3 years ago
7 0

Answer:

Endoplasmic reticulum.

Explanation:

Protein synthesis, sorting and transport is the important mechanism for the synthesis of protein in the body and the transport of the protein to its specific site or organ. The protein must reaches to its final destination for its proper functioning.

KDEL ( K- leucine, D is aspartic acid, E is glutamic acid and L is lysine ) is the stretch of a specific amino acid that are responsible for the protein molecule to target at its specific site. KDEL is specific for the transport of peptides to the endoplasmic reticulum.

Thus, the correct answer is option (A).

You might be interested in
Why do fruits have a hard endosperm?(1)
Fiesta28 [93]

Answer:

ion know

Explanation:

7 0
3 years ago
A cell with a diploid number of 24 undergoes MITOSIS, how many chromosomes are in each daughter cell?
GalinKa [24]

Answer:12.

Containing two complete sets of chromosomes, one from each parent.

Explanation:   Once mitosis is complete, the cell has two groups of 46 chromosomes, each enclosed with their own nuclear membrane. The cell then splits in two by a process called cytokinesis, creating two clones of the original cell, each with 46 monovalent chromosomes.

4 0
3 years ago
Read 2 more answers
How does an increase in volume affect the gas pressure in a balloon
GalinKa [24]

Answer:

Boyle's Law explains the relationship between volume and pressure. According to Boyle's Law, the volume of a fixed amount of gas decreases as its pressure increases. If the volume increases, its pressure decreases.

5 0
3 years ago
Read 2 more answers
The small size of cells
puteri [66]

Answer:

A

Explanation:

this is because, in smaller organism their SA/V ratio is large hence they have efficient transport of materials within their cells

5 0
3 years ago
Explain the scientific theory of cells
Tcecarenko [31]
All,organisms are made up of one or more cells. The cell is the basic unit of all organisms. All cells come from existing cells. The scientific theory of cells is what scientists believe are true about cells.
3 0
3 years ago
Read 2 more answers
Other questions:
  • He process of exchanging oxygen and carbon dioxide between the alveoli and the blood of the capillaries is called:
    8·1 answer
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Which substance should have the highest pH? lemon juice bathroom cleaner vinegar distilled water
    7·2 answers
  • The purpose of nervous tissue is
    8·1 answer
  • Which of the following is most likely to result in an action potential at a postsynaptic neuron? Which of the following is most
    6·1 answer
  • How do living cells use the instructions in their DNA to perform tasks?
    14·1 answer
  • Sexual reproduction creates
    12·2 answers
  • The complementary strand of DNA to the DNA fragment GGC ATA CAT is: (DNA replication)
    5·1 answer
  • What effect does exercise have on cellular respiration?
    5·1 answer
  • Explain why it is not accurate to call a virus that kills bacteria a “bacteria eater."
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!