1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anyanavicka [17]
3 years ago
8

Darwin argued that the beak size and shape of Galapagos finch species was related to their A. food source.B. time of reproductio

n. C. flight pattern. D Body size
Biology
1 answer:
Ugo [173]3 years ago
8 0
A. Food Source. Each finch had a different beak specifically designed to help them obtain their food.
You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Place the steps of the respiration process in the correct order.
faust18 [17]

1. Air enters the nostrils.

2. Air passes from the trachea to the bronchi

3. Air diffuses from the alveoli to the blood cells.

4. Oxygen enters the blood cells.

5. Blood transports oxygen to other cells.

8 0
2 years ago
In a plant called jimsonweed, flowers can be white or purple. A jimsonweed plant with white flowers is crossed with a jimsonweed
STALIN [3.7K]

<u>Answer:</u>

Although statements are not given in the question, we could make the most possible deduction as follows:

The allele for purple flowers is dominant whereas allele for white flowers is recessive.

<u>Explanation:</u>

According to the question,

  1. Purple flower plant was crossed with white flower plant.
  2. All offsprings have purple flowers.

Here we have one possibility that both parents were homozygous but in their own traits. <u>Purple flower</u> plants were "PP" and white <u>flower plants</u> were "pp" So, the <u>first progeny</u> (direct offsprings) would have "Pp". So, as per considerations, purple is dominant allele which will mask the recessive allele thus defining the color of all offsprings as purple. However, further cross of their generation will definitely end up into purple and white flowers (3:1) but this condition is not mentioned in the statement.

8 0
3 years ago
A mineral made of oxidized hydrogen
natta225 [31]
Oxidized hydrogen does not participate in mineral formation.
7 0
3 years ago
Examine the genotypes shown, there is a pattern that explains why polygenes are also called “ADDITIVE.” What is the pattern?
Otrada [13]
The pattern that explains why polygenes are called additive are the dominant and recessive genes incorporated.
5 0
3 years ago
Other questions:
  • What does the principle of uniformitarianism state?
    15·1 answer
  • What function does diffusion have in the cell
    15·1 answer
  • Elk herds in Yellowstone National Park are herbivores that eat on the available vegetation. Which factor is important to ensure
    7·2 answers
  • What term describes one organism eating another organism?
    10·2 answers
  • A group of organ systems that work together to perform a common function
    10·1 answer
  • Which plant is often used as a soil conditioner
    5·2 answers
  • QUESTION 1
    7·1 answer
  • How does the Hardy-Weinberg equation work? With only the information q2=0.0036, how do I find the other numbers? I would greatly
    9·1 answer
  • In a mammalian visual system, visual information is integrated at ________.
    9·1 answer
  • Both metals and nonmetals are __________.<br> conductors <br> elements <br> solids
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!