All categories

3 years ago

What is the relationship between cellular respiration and photosynthesis?

Biology

1 answer:

Alex Ar [27]3 years ago

8 0

Answer:

Explanation:

Photosynthesis converts carbon dioxide and water into oxygen and glucose. Glucose is used as food by the plant and oxygen is a by-product. Cellular respiration converts oxygen and glucose into water and carbon dioxide. Water and carbon dioxide are by- products and ATP is energy that is transformed from the process

You might be interested in

What term describes a species that is brought into an ecosystem where it does not naturally occur? competitor species threatened

vaieri [72.5K]

Its introduced species

6 0

3 years ago

Read 2 more answers

Which trophic level has the most energy

Natasha2012 [34]

Answer:

The lowest level, which is usually the producers.

Explanation:

This is because on every level of the trophic system, some energy is lost before the next level. So the level with the least lost energy is the lowest

6 0

3 years ago

Schools are looking for a balanced food option to serve their students.

denis-greek [22]

Schools have to give proper meals and carbohydrates to students.

<h3>What is a balanced diet?</h3>

A balanced diet is one that includes a variety of foods in the right amounts and ratios to meet the body's needs for calories, proteins, minerals, vitamins, and other nutrients. A small portion of the diet is also set aside for extra nutrients to last through the brief period of leanness. In this situation, we must choose a unique menu that offers the

In this context, we have to first prepare the list of the number of carbohydrates, lipids, and proteins and then we have to identify the maximum amount required in the meal. then observe the common food in the school.

Learn more about a balanced diet here:

brainly.com/question/10669660

#SPJ1

6 0

2 years ago

What would happen if the aerobic respiration process broke down in a tropical rain forest?

igomit [66]

The right answer for the question that is being asked and shown above is that: Aerobic Respiration by definition is<span> the process of producing cellular energy involving oxygen. If </span><span>the aerobic respiration process broke down in a tropical rain forest, then the tropical rain forest cannot produce foods.</span>

5 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago