1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tasya [4]
3 years ago
13

Tumor-suppressor genes help prevent uncontrolled cell growth. One that is found mutated (and therefore nonfunctional) in more th

an 50% of human cancer is p53. So important is the p53 gene that it is sometimes called the "guardian angel of the genome." Describe the double whammy that results from mutation of p53.
Biology
1 answer:
Paha777 [63]3 years ago
4 0

Answer:

p53 helps the cells from passing on mutations that lead to DNA damage. Hence, it is known as the guardian angel of the cell as it helps fight against cancer. However, if p53 becomes defective or missing, then the mutations will lead to cancer.

Mutations in the p53 can also cause the tumor-suppressing genes to convert into tumor causing genes. Hence, mutations in such kind of genes can be very harmful for the body.

You might be interested in
Identify the molecules in the plasma membrane that provide basic membrane structure, cell identity, and membrane fluidity.
Nimfa-mama [501]

The main molecules present in the plasma membrane are<em><u> phospholipids</u></em>, those molecules are made of a polar, hydrophil end(glycerol with a phosphate group attached) and two non-polar, hydrophobe ends(two fatty acids rests). The cell identity is determined by <u><em>proteins </em></u>present in the membrane, a  very important type of protein that determines the identity of a specific cell is called marker. The membrane fluidity is reduced by a lipid with a ring structure, <u><em>cholesterol</em></u>, this molecule belongs to a class of biomolecules called steroids.

5 0
3 years ago
What are some benefits of genetically engi-<br> neered crops?
Stella [2.4K]

Answer:

More nutritious food.

Tastier food.

Disease- and drought-resistant plants that require fewer environmental resources (such as water and fertilizer)

Less use of pesticides.

Increased supply of food with reduced cost and longer shelf life.

Faster growing plants and animals.

Explanation:

Please give me brainliest

5 0
3 years ago
Read 2 more answers
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Explain in your own words what the CSI effect is. Describe how it changes the perception of potential jurors. Would the CSI effe
Marianna [84]

Answer: To me the csi effect is a widely held idea among law enforcement and prosecutors that television series that posses forensic science may want the juror to encourage heavy use of forensic evidence in a case or may want more forensic evidence for convicting criminals of their crimes

Explanation:It could as I’d maybe want people to be properly convicted of their crimes …why ? A lot of people who go to prison are innocent all because of over looked evidence ….why not? Well a cause could be open for too long when ….it’s not that big of an issue

4 0
2 years ago
These pairs of forces are known as __________ reaction pairs because one pushes against the other with an equal but opposite for
Ira Lisetskai [31]
These pairs of forces are known as <u>action</u> reaction pairs because one pushes against the other with an equal but opposite force.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Do you think monogamy and polygamy are reproductive strategies?
    7·2 answers
  • What is the purpose of fertilization in terms of chromosomes
    7·1 answer
  • Please help!!!!!! 20 points!!!!!! will be appreciated....
    11·2 answers
  • Do particles have weight and or mass?
    13·1 answer
  • Whoch action occurs at divergent plat boundaries HURRY!
    12·1 answer
  • 1. Which of the following transport mechanisms utilizes energy?
    14·1 answer
  • Limb bones within unrelated animals that have the same basic structures are considered what
    11·1 answer
  • Do my diffusion Assignment for 30 pts
    14·2 answers
  • PLEASE HELP True or False
    9·1 answer
  • Which statement describes the offspring F1
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!