1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ede4ka [16]
3 years ago
13

Answer the questions based on the information given.

Biology
2 answers:
Ket [755]3 years ago
4 0

Answer:

What is the rate of motion of the Amur plate?

5 mm/year

Where would the plate be after 1 million years?

5,000 meters east

What geologic feature will form between the Amur and Eurasian plates?

new ocean floor

I JUST DID IT, IT IS CORRECT

shusha [124]3 years ago
3 0

What is the rate of motion of the Amur plate? Express your answer in .  

✔ 5 mm/year

Where would the plate be after 1 million years? Express your answer in m.  

✔ 5,000 meters east

What geologic feature will form between the Amur and Eurasian plates?  

✔ new ocean floor

You might be interested in
How does Matter move throughout the ecosystem
GrogVix [38]

Answer:

In ecosystems, matter and energy are transferred from one form to another. ... Nutrients and living matter are passed from producers to consumers, then broken down by decomposers.

Explanation:

6 0
4 years ago
An organism with genotype TtSs can normally make all the following gamete combinations except:
Crank
It can not make the combination of TT
7 0
4 years ago
Read 2 more answers
Earthquakes and volcano eruption are rare events is this true or false
Jet001 [13]
Yes, they are rare events
true
6 0
3 years ago
Explain how the fats, sugars and/or starch contained in seeds or milk are useful for the plant sprouting from the seed or the ba
kobusy [5.1K]
<span>Fats are high energy molecules that assist in a growing organism. There is a lot of calories in fat that can be used for growth.When metabolising fat it produces carbon dioxide, water, and ATP. Sugars and/or starch is useful in the same method, they provide calories necessary for a seed or baby animal to grow. The starch can be cleaved into more managable sugars, and the sugars used in glycolysis and then the products of glycolysis used in the citric acid cycle. Used together an organism would have water from the fat that can be used to hydrolyze the sugars that it would consume to produce ATP.</span>
8 0
4 years ago
Which of these processes produces the MOST oxygen ?
bazaltina [42]

The right answer is D) photosynthesis in plants

Cellular respiration does not produce oxygen, it consumes it rather. The same for the respiration of animals and the human being.

The degradation of organic matter does not produce oxygen.

Photosynthesis is the only one of these proposals that produces oxygen, and this process belongs to the plants.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Secondary succession occurs in an area where the community has been destroyed and the soil has been _____.
    14·2 answers
  • What develops when cells undergo metastasis
    7·2 answers
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Which of these biomes tends to have the coldest temperatures? A. Rain forest B. Temperate forest C. Taiga D. Savanna
    6·2 answers
  • The regulation of gene expression must be more complex in multicellular eukaryotes than in prokaryotes because
    12·1 answer
  • 5.) What is the process by which the egg is released called?
    10·1 answer
  • List ten sources of water polution (LIST FORM, NOT LIKE AN ESSAY PLEASE!)
    11·1 answer
  • MY
    8·1 answer
  • What will you have in 500 years????
    14·1 answer
  • Homologous chromosomes possess the same genes arranged in the same order but may possess different __________ of some of these g
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!