1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jek_recluse [69]
3 years ago
7

"Which concept is best illustrated by this diagram?

Biology
2 answers:
Elenna [48]3 years ago
6 0
I would rather suggest Second option ! it is only describing the life function of a cell !!!
Nimfa-mama [501]3 years ago
5 0

Answer:

(2) Single-celled organisms carry out life functions that are essential for survival.

Explanation:

Unicellular organisms are those organisms which are composed of only one cell.  Examples of unicellular organisms are <em>Amoeba</em>, <em>Paramecium</em> and <em>Euglena</em>. These also called single-celled organisms. Unicellular organisms may have eukaryotic cell or prokaryotic cell. In the question, the diagram is of a eukaryotic cell. Since a cell is the structural and functional unit of life, the unicellular organisms perform life processes or life functions such as feeding, digestion, respiration and excretion carried out in one cell for their survival.

You might be interested in
Which is the BEST description of a macromolecule?
otez555 [7]

Answer: a molecule made of many small molecules

Explanation: Macromolecules are large molecules that are composed of smaller molecules called monomers. These macromolecules are polymers of the monomers units. Examples of macromolecules are proteins which have amino acids as their monomers and carbohydrates which have monosaccharide sugars such as glucose, and fructose as the monomers.

5 0
3 years ago
Chose all that apply for spring tides
AURORKA [14]

Answer:

lol

Explanation:

I don't know good luck

5 0
3 years ago
Read 2 more answers
What percent of<br> an adult<br> animal's body is<br> water?<br> 15%<br> 75%<br> 45%<br> 90%
Lisa [10]
I think 75% or 90% (I looked it up lol)
7 0
3 years ago
Read 2 more answers
How can roots, stems, and leaves all be involved in food storage?
shepuryov [24]

Answer:

Plant produces food material in the process of photosynthesis in the leaves. The food that is produced in the form of glucose (sugar) is transported from the leaves to other parts of the plants such as roots, stem and seeds with the help of water. When the glucose reaches to the storage part it is stored in the form of starch.

For example, in carrot and potato food is stored in roots while in sugar cane the food is stored in the stem.

8 0
3 years ago
5. In 1928, Alexander Fleming noticed that a mysterious blue-green fungus had grown on some bacterial colonies that were known t
Otrada [13]

Answer:

The steps that can be seen in this story are observation and the questioning phase, which can also be called elaboration of the problem.

Explanation:

The scientific method is a set of phases that are able to guide researchers to the creation of scientific knowledge, through an experiment. This method is essential for conducting scientific research, allowing an experiment to be managed in a way that promotes answers to scientists' questions. The scientific method presents the phases called observation, questioning (or elaboration of the problem), elaboration of hypotheses, experimentation, analysis of the results and conclusion.

In the story shown in the question above, we can see the phases called observation and questioning. The observation takes place the moment Fleming noticed a fungus capable of growing on colonies of bacteria that cause throat infections, killing them. This observation made him enter the questioning phase, when he wondered if the fungus was able to prevent the growth of these bacteria.

8 0
3 years ago
Other questions:
  • how do roller coaster engineers and park safety manager address the excessive G- forces exerted by roller coaster on its riders?
    11·1 answer
  • How does the sun effect the plants
    10·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • 10. What happens to atmospheric pressure as a person rises in altitude?
    13·2 answers
  • Why Is Diffusion Important To Plants And Animals?
    9·1 answer
  • Chronic exposure to nicotine desensitizes _______ receptors in the midbrain.
    14·1 answer
  • An increase in seawater density can be caused by a ________ in temperature or a/an ________ in salinity
    10·2 answers
  • The volume of air in the lungs is controlled by the​
    10·1 answer
  • The plasma membrane A. controls movement of substances in and out of the cytosol B. has both lipid and protein molecules C. is i
    12·1 answer
  • you discover a new microbe while working on a citizen scientist project. the microbe is taken to a lab that specializes in placi
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!