1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
3241004551 [841]
3 years ago
6

Observations and inferences are important in science. How would you explain the differences between the two words?

Biology
1 answer:
Andrews [41]3 years ago
7 0

Explanation:

when you Observe, you describe what you are seeing at the moment. so observation means seeing.

inference is the result you receive by observation.

for example, "I threw a stick and the dog ran after it and brought it back to me" this is an observation. you don't mention the reason why the dog brought you the stick. you just describe what happened!

but if you say, "the dog was trained to bring back the stick." you are mentioning the reason of the dog's behavior and that's inference.

You might be interested in
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
Elden [556K]

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

4 0
3 years ago
How can a black hole be detected even though its gravitational field is too strong for light to escape?
Vaselesa [24]
We can infer the presence of black holes and study them by detecting their effect on matter nearby.
4 0
3 years ago
Read 2 more answers
Making Comparisons Read the description of how
Kay [80]

Answer:

Fossil fuels are produced by the same geological processes.

Explanation:

Fossil fuels form when organic matter which has been buried in the Earth over a long period of time is subjected to heat and pressure over a long period of time. Heat and pressure are both critical components for the formation of a fossil fuel. The process of the formation of fossil fuel is the same today as it was in the past. The geological processes are the same for the formation of fossils.

5 0
3 years ago
*FLVS Biology* plz no scams or links or you will be reported! the question is in the picture you click below!! and add a little
Jobisdone [24]

Answer:

the picture is blower.

do a clear clicking

3 0
3 years ago
Evelyn's ______ is the practical use of solar power in a vacuum cleaner that is designed to effortlessly vacuum clean the floors
Dmitry [639]

Answer:

Evelyn's ______ is the practical use of solar power in a vacuum cleaner that is designed to effortlessly vacuum clean the floors of on-the-go and elderly consumers.

A) product idea

B) product concept

C) product image

D) prototype

E) promotional product

Answer: B

Explanation:

Evelyn's product concept from the above was born from thorough research to determine best quality and best performance product for her target market- her on-the-go and elderly consumers. The product concept is a very important concept in marketing that deals with maximizing product features to suite target market, therefore reaching market potential.

7 0
3 years ago
Other questions:
  • A week after a near-drowning incident, a 6-year-old boy presents with respiratory distress, tachypnea, and fever. What should yo
    5·1 answer
  • Similarities between exothermic and endothermic
    7·1 answer
  • The two-point discrimination test is used to determine ________.
    12·1 answer
  • Which of the following statements is correct? a. RNA contains the genetic code. b. RNA reads and translates the DNA code c. DNA
    9·2 answers
  • Which one of these is not an example of intracellular communication?
    14·2 answers
  • Which produces the sediments that ultimately lead to soil formation?
    5·2 answers
  • Need help with 2 science 10 questions (20 points)
    14·1 answer
  • Each step or level of the food chain forms a__________
    11·2 answers
  • This type of cell is found in females and is needed for reproduction​
    12·2 answers
  • All the different plants, animals, fungi, microorganisms, and variety of ecosystems found on Earth
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!