1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yKpoI14uk [10]
3 years ago
12

What is the purpose of the fruit that develops on a flowering plant?

Biology
1 answer:
Sunny_sXe [5.5K]3 years ago
3 0
For attracting insects for pollination
You might be interested in
Patient has been sick for 9 days with the flu, which immune response is
VladimirAG [237]
Answer: humoral immune response

The main antibody isotypes in the influenza-specific humoral immune response are IgA, IgM and IgG. Mucosal or secretory IgA antibodies are produced locally and transported along the mucus of the respiratory tract by transepithelial transport and can afford local protection from infection of airway epithelial cells.
3 0
3 years ago
What fraction of species on the planet been threaten by humans?
Paul [167]
I think it is one-third. 
8 0
3 years ago
The portion of the brain that is sometimes referred to as the hindbrain is the:
notsponge [240]
I believe this would be the cerebellum.  This part of the brain is used for motor control like moving the fingers say and cognitive functions (to do with thinking) and also can affect the feelings of pain and pleasure. 
6 0
2 years ago
Which of the following plants have swimming sperm
MaRussiya [10]
The answer would be both A and B (: Which is C.
8 0
3 years ago
What compares the number of events that occurred to the total number of possible events.
Dmitrij [34]
I THINK!!! a. but i could be wrong sry if i am
8 0
3 years ago
Other questions:
  • Which system is the digestive system least connected to?
    15·2 answers
  • The brain and spinal cord are known as the central nervous system(CSN). The spinal cord contains nerves that send information to
    12·1 answer
  • Que es recombinacion genetica artificial?
    10·1 answer
  • What is the wavelength shown in this picture?
    12·1 answer
  • What is the active site and what is it’s job
    5·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • What happens to molecules of a substance during convection
    7·1 answer
  • why do cold-blooded animals, such as snakes and turtles, need to bask in sunshine before they can move as quickly as warm-bloode
    14·1 answer
  • for patients with prediabetes, what strategies does the diabetes prevention program show are effective in reducing the risk of p
    7·1 answer
  • Plan an investigation on how temperature affects seed germination. ​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!