1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tia_tia [17]
3 years ago
10

What are the two substances that maybe formed in anaerobic respiration

Biology
1 answer:
tester [92]3 years ago
8 0
<span>it the lactic acid and pyruvic acid I think</span>
You might be interested in
When female deer mate with male deer that have the largest antlers, _______ selection is occurring. A. random B. sexual C. stabi
erik [133]
The answer is b sexual i think 
8 0
3 years ago
Read 2 more answers
Describe the process and purpose of cell fractionation
jolli1 [7]
Mama mia thatsa spicy meataballa
8 0
3 years ago
What is one of the functions controlled by the cerebellum? A. balance B. digestion C. respiration D. memory
Brums [2.3K]

Answer:

A. Balance

Explanation:

The cerebellum receives information from the sensory systems, the spinal cord, and other parts of the brain and then regulates motor movements. The cerebellum coordinates voluntary movements such as posture, balance, coordination, and speech, resulting in smooth and balanced muscular activity. It is also important for learning motor behaviors.

3 0
3 years ago
What are parts of the cell theory
Studentka2010 [4]
Cell Theory #1Cells are the basic structure and function of a living thingCell Theory #2All organisms (living things) are made out of cellsCell Theory #3<span>only existing cells can make new cells</span>
5 0
3 years ago
Read 2 more answers
If the release of thyroid hormone (TH) was regulated by a long-loop negative feedback, where would you find the cells that are i
pav-90 [236]

Answer:

Hypothalamus and anterior pituitary gland.

Explanation:

Lower levels of T3 and T4 in the blood or lower metabolic rate serve as signal and stimulate the release of thyrotropin-releasing hormone (TRH) from the hypothalamus. The TRH stimulates the anterior pituitary gland to release thyroid-stimulating hormone (TSH) which in turn makes the thyroid gland to release the thyroid hormones.

The elevated levels of thyroid hormones inhibit the release of TRH from the hypothalamus and that of TSH from the anterior pituitary gland.

Hence, the cells of hypothalamus and anterior pituitary gland would be inhibited by the binding of thyroid hormone to regulate the release of these hormones by a negative feedback mechanism.

8 0
3 years ago
Read 2 more answers
Other questions:
  • What are the results of having dilated arteries during exercise?
    13·1 answer
  • How is a tendon different from a ligament
    7·2 answers
  • Why do scientists use a light year to measure distances in space?Do you think there is a better way to measure distance? Explain
    15·1 answer
  • Is a pelican a herbivore carnivore or omnivore?
    10·1 answer
  • At what point during protein synthesis are genes<br> expressed?
    9·1 answer
  • These organisms of a name that means "Skinny spined"
    8·1 answer
  • What do you do if you have blood on chicken wings?
    14·2 answers
  • A mineral must be which of the following? select all that apply
    7·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • READ CAREFULLY!!! THE OTHER ANSWERS ON BRAILY ARE NOT THE SAME AS THESE Which of the following would be most likely to cause a m
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!