1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
snow_tiger [21]
3 years ago
11

An active continental margin has ___ while a passive margin does not

Biology
2 answers:
mojhsa [17]3 years ago
6 0
Your answer is Subduction. ☺
evablogger [386]3 years ago
6 0

Answer:

The given blank can be filled with subduction.

Explanation:

An active continental margin is witnessed on the prominent edge of the continent where it is colliding into an oceanic plate, that is, the process of subduction taking place. The active margins are generally the locations of tectonic activity.  

On the other hand, passive continental margins are witnessed along the left coastlines. As there is no subduction or collision occurs, there is least tectonic activity taking place and the processes of erosion and weathering take place the most.  

You might be interested in
What happens to a living organism that does not obtain all four main types of macromolecules
GREYUIT [131]

Answer:

Living organism should obtain the 4 main types of macromolecules for maintaining proper body physiology.

Explanation:

The four major types of macromolecules that we should intake are Carbohydrate,protein,fat and nucleic. Each of them performs their specific functions.The 4 macromolecules are deeply interlinked to each other.

          Deficiency of one of these four macromolecules can leads to various health hazards or health abnormalities.

    For example if we do not intake carbohydrate then the lack of carbohydrate will weakens the body.The brain will not get sufficient amount of glucose to exhibit its biological function.

   The protein deficiency leads to the development of marusmus a phusiological disorder occur due to protein energy malnutrition.

3 0
3 years ago
The energy pyramid below illustrates some feeding relationships in alpine meadows of Yellowstone National Park. Which statement
Anettt [7]

Answer:

The answer is - Biomass decreases as energy is transferred from one level to another.

Explanation:

The options are;

A. Chipmunks and insects can occupy the same niche.

B. As the number of bears in this community increases, the number of chipmunks will increase.

C. Insects are classified as omnivores in alpine meadow communities.

D. Biomass decreases as energy is transferred from one level to another

The answer is D. Biomass decreases as energy is transferred from one level to another

The energy pyramid being referred to is in the attachment below.

Biomass is an organic renewable source of energy derived from plants and animals. As animals at the lower trophic levels are consumed by animals at the higher trophic levels there is transfer of energy, however it is not all the energy that are transferred equally. As a result, at each trophic level there is decreased energy and biomass that is transferred from one level to the other.

3 0
3 years ago
How does the insertion mutation affect the DNA?
gtnhenbr [62]
An insertion mutation occurs when an extra nucleotide is added to the DNA strand during replication. This can happen when the replicating strand "slips," or wrinkles, which allows the extra nucleotide to be incorporated (Figure 2). Strand slippage can also lead to deletion mutations. I’m not sure if this right but I tried
4 0
3 years ago
Q40.is a proposed explanation for an observation.
Tcecarenko [31]

Answer:

C. Hypothesis

Explanation:

Hypothesis is a proposed explanation for a certain occurrence and when the explanation is conclusive, then it becomes a theory.

3 0
2 years ago
Explanation on Mitosis​
Kipish [7]
Mitosis is the division that results in two “daughter” cells. Both of these daughter cells have the same number of chromosomes as the “parent” cell.
Mitosis consists of 4 phases: prophase, metaphase, anaphase, and telophase.
Prophase: the DNA is copied and the chromosomes pair up
Metaphase: the chromosomes line up in the middle of the cell
Anaphase: sister chromatids are pulled apart from each other towards opposite sides of the cell
Telophase: the cell begins to pinch in the middle and separates into two identical daughter cells
3 0
3 years ago
Other questions:
  • Which type of cell is a lactobacillus
    10·1 answer
  • A bacterium that is transformed: Select one:
    13·1 answer
  • If a plant cell is given only sunlight and water, it cant make sugars through photosynthesis why
    12·1 answer
  • The light from the sun heats a metal surface. This is an example of
    6·2 answers
  • Contrast the location of genetic material in bacterial cells to its location in plant and animal cells
    8·1 answer
  • How does the heart work
    9·1 answer
  • How do the circulatory and respiratory systems work together for gas exchange?
    13·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What genetic and other changes might have caused these cells to escape normal cell cycle regulation these cells are hela cancer
    6·1 answer
  • In exchange of useful chemicals between organisms and their abiotic environment is an example of what
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!