Toxic water quality in the Klamath River is a direct result of both upper basin agricultural development (the draining of wetlands and intense chemical use), and the presence of PacifiCorp's dams, creating warm, stagnant pools for algae to develop. Massive algae pools in Upper Klamath Lake.
The force of gravity is a major force that created the earth. As rocks and ice clumped together as they spun around the newly formed star (sun), the force of gravitational pull increased and attracted more debris (rocks and ice). The clumps of rocks, debris, and ice, therefore, grew into a planet.
Another is electromagnetic force. The spinning currents in the outer core of the earth create a dynamo effect that forms a magnetic field around the earth. This shields the earth from the solar storms of the sun hence protects life and the atmosphere.
Weak nuclear force is responsible for maintaining the heat of the earth’s interior which is critical for maintaining the dynamo effect of the outer core so the earth is protected by its magnetic field.
Answer:
is D ------------------------
Hair cells bend toward the kinocilium, so yeah, have fun
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
