1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nostrana [21]
3 years ago
13

Where is the Oort cloud located?

Biology
2 answers:
Diano4ka-milaya [45]3 years ago
8 0

Answer:it’s C

Explanation:

sattari [20]3 years ago
7 0

Answer:

Beyond the kuiper belt at the farthest end of the solar. on edgenuity 2020

Explanation:

You might be interested in
Darwin observed that the finches on two different islands in the Galapagos belonged to the same family, but showed a lot of vari
trapecia [35]
<span>This variation be justified by:
</span>Migration to an environment different from their birthplace, and adaptation to the available food, ultimately leading to speciation. because <span>birds use their beaks to eat.</span>.
3 0
2 years ago
Read 2 more answers
Help me with this I willl mark you brainlyest I got test due
erica [24]
Was AA, KK, and TT correct?
3 0
3 years ago
Resources from the ocean are found in many regions, but the majority of all resources are located in which region?
alexandr1967 [171]
Lots of resources are located in the United States. Such as oil, gold, silver, iron, and much more.
3 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
How does energy flow through an ecosystem?
BaLLatris [955]

the answer is the sun


3 0
3 years ago
Other questions:
  • The ____ can be described as the basic unit of life.<br><br> atom<br> neutron<br> cell<br> nucleus
    13·1 answer
  • Which of the following is a characteristic of alcoholic fermentation?
    6·2 answers
  • Is coronary circulation the same as pulmonary circulation?
    13·1 answer
  • How does climate change affect the ocean ecosystem?
    13·2 answers
  • How can biotic and abiotic factors in an ecosystem affect populations? I need 2 examples of each pls
    13·1 answer
  • Rachel was very sick with a bacterial infection. The infection was treated with antibiotics. Rachel seemed to get well, but in a
    7·1 answer
  • What happens to the atoms of a solid when the temperature increases?
    8·1 answer
  • In non-medelian genetics, chickens have a trait for feather color. Black is dominant and so is white. The heterozygous version o
    7·1 answer
  • Which of the following is a lipid-protein substance produced by neuroglial cells?
    6·1 answer
  • What type of reproduction is shown in the diagram?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!