1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WARRIOR [948]
2 years ago
5

Which of the following can be found in a community? (click all that apply)

Biology
1 answer:
galina1969 [7]2 years ago
4 0

Answer: All

Explanation: A community is an assembly of one or more species that interacts with one another. However, in a community, the organisms would also interact with their environment.

You might be interested in
What Is a Siamese Fighting Fish and it's average lifespan in captivity?
nordsb [41]

Answer:

The siamese fighting fish (also commonly known as betta fish) is a freshwater fish found in some parts of asia. They are known to fight other fish of their kind, hence the name siamese <u>fighting</u> fish. They usually live between 2-5 years in captivity.

5 0
2 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
A transcriptional repressor that controls the transcription of gene A is not normally active unless bound by an effector molecul
hoa [83]

Answer:

C

Explanation:

I think its C . A transcriptional repressor usually represses the transcription pathway when its active. According to the question, the repressor is not usually active until an effector molecule binds to it making it active and blocking the transcription pathway. So if the region where the effector binds on the repressor is mutated i.e. it turns nonfunctional that means the effector cannot bind to repressor which means repressor cannot become active to block transcription which in turn increases the transcription of gene A because repressor cannot repress it since it is inactive due to its inability to bind to the effector.

ALOT of words please lmk if it makes sense

6 0
3 years ago
Describe the process of speciation. Include in your discussion the factors that may contribute to the maintenance of genetic iso
ivolga24 [154]

Speciation is the process by which new and distinct species are formed. One of the most important factors necessary for speciation to occur is the genetic isolation of two populations. This genetic isolation can, over long periods of time, cause these two groups to become genetically incompatible. Factors that can lead to this genetic isolation include geographic separation and hostility among population groups. 

3 0
3 years ago
Which plant adaptation would likely be found in taiga
IrinaK [193]
Many trees are evergreen so that plants can photosynthesize right away when temperature rise, many trees that have needle-like leaves which shape  losses less water and sheds snow more easily than broad leaves waxy coating on needle-like prevent evaporation need-like leaves are dark in color allowing solar heat to absorbed many trees have branches that droop downward to help shed excess snow to keep the branches from breaking.
4 0
3 years ago
Read 2 more answers
Other questions:
  • GIVING BRAINLIEST!!! ANSWER ASAP
    9·2 answers
  • Identify the primary role of the lymphatic system? a) Delivery of oxygen to the deep muscle cells b) Produce and store large num
    12·1 answer
  • Most human cells have 23 chromosomes
    11·1 answer
  • a woman who is heterozygous for hemophilia marries a normal man. what will be the possible phenotype ratio of their children?
    10·1 answer
  • Using the following cladogram, put the following organisms in order from most evolved to
    8·1 answer
  • The _____ is the primary channel for the transportation of water, mineral and food from the roots and leaves to the rest of the
    12·1 answer
  • How might the production of antibiotics and odours have evolved?​
    10·1 answer
  • How do bacteria and archea reproduce most of the time?
    14·2 answers
  • Does anyone have pokemon shield
    10·2 answers
  • Name one structure found in an animal cell that is not found in a plant cell.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!