1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
enot [183]
3 years ago
7

Flowing water picks up sediment and carries it to a new location. this is a example of

Biology
1 answer:
jonny [76]3 years ago
6 0
C. erosion should be the answer, though this is more of an example of deposition.
You might be interested in
We would expect cells found in the active muscles of animals to contain relatively large amounts of which cellular organelle? A)
Mars2501 [29]

Answer: B.) Mitochondria

Explanation:

3 0
2 years ago
Explain Mercury is the planet closest to the Sun. Why does it get so cold at night?
alexdok [17]

Answer/Explanation: On Mercury temperatures can get as hot as 430 degrees Celsius during the day and as cold as -180 degrees Celsius at night.

Mercury is the planet in our solar system that sits closest to the sun. The distance between Mercury and the sun ranges from 46 million kilometers to 69.8 million kilometers. The earth sits at a comfy 150 million kilometers. This is one reason why it gets so hot on Mercury during the day.

The other reason is that Mercury has a very thin and unstable atmosphere. At a size about a third of the earth and with a mass (what we on earth see as ‘weight’) that is 0.05 times as much as the earth, Mercury just doesn’t have the gravity to keep gases trapped around it, creating an atmosphere. Due to the high temperature, solar winds, and the low gravity (about a third of earth’s gravity), gases keep escaping the planet, quite literally just blowing away.

Atmospheres can trap heat, that’s why it can still be nice and warm at night here on earth.

Mercury’s atmosphere is too thin, unstable and close to the sun to make any notable difference in the temperature.

Space is cold. Space is very cold. So cold in fact, that it can almost reach absolute zero, the point where molecules stop moving (and they always move). In space, the coldest temperature you can get is 2.7 Kelvin, about -270 degrees Celsius.

Sunlight reflected from other planets and moons, gases that move through space, the very thin atmosphere and the surface of Mercury itself are the main reasons that temperatures on Mercury don’t get lower than about -180 °C at night.

6 0
3 years ago
Which codon is the code for the amino acid serine (Ser)?
Ira Lisetskai [31]

Answer:

four codon in mRNA sequence code for serine aminoacid.

Explanation:

UCA

UCG

UCC

UCU

these four codons code for aminoacid serine.

4 0
3 years ago
A single chromosome contains many genes. <br> True <br> False
seraphim [82]

Answer:

True . It contains hundreds to thousands genes.

7 0
3 years ago
Read 2 more answers
What are the different color patterns produced by the prism called?
UkoKoshka [18]
IT IS CALLED SPECTRUM.
8 0
3 years ago
Other questions:
  • explain why it is good to sweat during/after a workout. What might happen if an athlete did not sweat?
    6·1 answer
  • Which component of energy expenditure is the most variable from one individual to another? adaptive thermogenesis thermic effect
    13·1 answer
  • Embryonic stem cells have the potential to?
    10·1 answer
  • An investigator wants to understand whether a newly found membrane protein is involved in membrane transport of a certain partic
    13·2 answers
  • Where is the flow of energy from the earth interior observable and measurable without sensitive scientific equipment
    10·1 answer
  • The following is a multi-step reaction. the rate-limiting step is unimolecular, with a as the sole reactant.
    15·1 answer
  • Which structures allow lycophytes to grow bigger than mosses and liverworts?
    14·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • TRUE OR FALSE evaporation occurs when water falls from clouds
    12·1 answer
  • The absorption of human-generated co2 by the oceans __________.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!