1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnesinka [82]
3 years ago
6

Caitlin wants to determine if a tomato plant grows better in potting soil or dirt. Which of the following describes the best set

up to conduct this type of investigation?
2 pots of the same size: one with 1 pound of potting soil, one with 2 pounds of dirt, 2 tomato plants of the same size and type
2 pots of different sizes: one with 2 pounds of potting soil, one with 2 pounds of dirt, 2 tomato plants of the same size and type
2 pots of the same size: one with 2 pounds of potting soil, one with 2 pounds of dirt, 2 tomato plants of the same size and type
2 pots of the same size: one with 2 pounds of potting soil, one with 2 pounds of dirt, 2 tomato plants of different sizes and the same type
Biology
2 answers:
Georgia [21]3 years ago
5 0
The answer with the 2 pots of the same size: one with 2 pounds of potting soil, one with 2 pounds of dirt, 2 tomato plants of different sizes and the same type
Korvikt [17]3 years ago
5 0

the answer is the third on, i got it correct on a test.

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Why are marshes more productive than bogs
ivolga24 [154]

The acidity of the soil-peat inhabits diversity of plant species compared to marshes.

An important distinction to bogs would be that marsh soils are more typically neutral in the pH scale, to slightly more basic.

Hope this helps! If it does, please go to my page and say thanks! Thankyou!

--Emilie Xx

8 0
3 years ago
Read 2 more answers
Can someone help me answer this easy question ?
sweet-ann [11.9K]

See that river on the bottom? That water has been flowing in the canyon for a long time and has slowly been chipping away at the rocks to give what you see today.

B. erosion from the water

7 0
3 years ago
Read 2 more answers
Biological processes that systematically vary over a 24-hour cycle are called _____ and are regulated by a cluster of neurons ca
Snowcat [4.5K]

Biological processes that systematically vary over a 24-hour cycle are called circadian rhythms and are regulated by a cluster of neurons called the suprachiasmatic nucleus.

<h3>What is the circadian rhythm?</h3>

The circadian rhythm refers to the biological process regulated by the duration of a calendar day, which is common for many organisms ranging from animals to plants.

The circadian rhythms enable the maintenance of homeostatic control of physiological functions and thus perform metabolic activities.

In conclusion, biological processes that systematically vary over a 24-hour cycle are called circadian rhythms and are regulated by a cluster of neurons called the suprachiasmatic nucleus.

Learn more about the circadian rhythm here:

brainly.com/question/4095233

#SPJ1

6 0
2 years ago
What caused the formation of the moons layer
vova2212 [387]

Answer:

when an object smashed into early Earth. .Explanation: no explanation just the answer

7 0
3 years ago
Other questions:
  • What happens if an animal cant adapt to their environment?
    7·2 answers
  • During the early stages of an enzyme purification protocol, when cells have been lysed but cytosolic components have not been se
    13·2 answers
  • What drug or drug class inhibits mobilization of free fatty acids from peripheral tissues?
    12·1 answer
  • Write a complementary dna bases of the following dna strand: CAAGGTACTAG
    7·1 answer
  • Human-induced environmental changes can affect living things at which level(s)?
    9·1 answer
  • The macronutrient(s) whose main functions are to contribute the basic building blocks (amino acids) and to synthesize, grow, and
    10·1 answer
  • What is the basic scheme of the nervous system
    5·1 answer
  • Each radioactive element has a constant rate of decay that is called its ________________.
    13·1 answer
  • What structures make up the male and female reproductive systems?
    7·1 answer
  • which organelle is responsible for manufacturing food in plants? I’m confused. Is it large vacuole or plastid?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!