1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Helen [10]
2 years ago
10

CHECKPOTS What is one method for controlling amebic dysentery?

Biology
1 answer:
Zarrin [17]2 years ago
6 0

wash your hands first! don't keep food open! cook properly! and lastly... no stale food!!!!

You might be interested in
The blood Group of Mother is O. The Blood Group of the Child is B. Man Exonerated If He to Blood Group?​
aalyn [17]

Answer:

If the mother's blood type is O, and the child's blood type is B, a man would be exonerated from paternity if he has blood type A or O.

Explanation:

In the above case, if a mother has blood type O and her child has blood type B, a man can be exonerated from paternity only if his blood type is A or O, and responsible if he is type B or AB.

The blood type is defined by the presence of surface antigens in the red blood cell, called A and B. The presence of each antigen is determined by a gene present on the parental chromosomes.

  • <em> </em><u><em>Blood type A</em></u><em> corresponds to the presence of gene A, and its genotypic expression can be A/A or A/O. </em>
  • <u><em>Type B blood</em></u><em>, whose genotype is B/B or B/O, is due to the presence of a gene containing the B antigen. </em>
  • <u><em>AB blood</em></u><em> —due to codominance— has one gene for A and another for B, with genotype A/B. </em>
  • <em>Blood type O, characterised by the absence of surface antigens, behaves like a recessive trait, which only manifests itself in the absence of surface antigens A and B. The genotype is O/O. </em>

By making a hypothetical crossing between mother and man, one can observe why he can be exonerated.

<u>Man with blood type O </u>

♂ O|O

♀ O|O

Alleles     O      O

O           O|O   O|O

O           O|O   O|O

The only possibility, in this case, is to have children with type O blood. No chance of children B.

<u>Male with blood type A </u>

♂ A|O

♀ O|O

Alleles     A        O

O            A|O    O|O

O            A|O    O|O

In this case there is a 50% chance that the children will be blood type A and 50% chance that they will be O. No chance of children B.

In the case of a man A|A the result is 100% probability of children A|O, and no probability of children B.

<em>So, a </em><em>man with blood types A (any genotype) and O, can be exonerated from paternity</em><em>, since it is </em><em>impossible for him to have a child of blood type B, when the mother is of blood type O</em>.

4 0
2 years ago
Tell how a food chain is different from a food web
Crank
<span>FOOD CHAINS FOLLOW A SINGLE PATH AS ANIMALS EAT EACH OTHER.

</span>
<span>FOOD WEBS SHOW HOW PLANTS & ANIMALS ARE INTERCONNECTED BY DIFFERENT PATHS.</span>
7 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
How many elements have been found to occur in nature?<br> 90<br> 092<br> 96<br> 99
wel

Answer:

92

Explanation:

5 0
3 years ago
Read 2 more answers
Who is Albert Einstein?
hodyreva [135]
Albert Einstein is an inventor and scientist, he was one of the main reasons the us is the us right now. Hope this helped!
5 0
2 years ago
Read 2 more answers
Other questions:
  • Cholera is a waterborne pathogen that causes severe gastrointestinal disease. The organism is a slightly curved, gram-negative r
    13·1 answer
  • Which factors affect the temperature of a region? Check all that apply.
    7·2 answers
  • Which form of life on land appears in the fossil record before all the others?
    11·2 answers
  • Which statement explains why a mother’s unhealthy diet during pregnancy is harmful to her embryo’s development? *
    13·1 answer
  • What do theories hypothesis about the conditions of Earth's early atmosphere?​
    15·2 answers
  • How are these cancer cells different from “normal” cells? Include how “homeostasis” affected in your explanation
    8·1 answer
  • Which effect of temperature rise causes a feedback resulting in a rise in global temperatures?
    11·1 answer
  • Chemical energy is used to do work in cells because the bonds in molecules contain ____________ energy.
    12·1 answer
  • The menisci found in some synovial joints are attached to the ______ at the periphery of the joint cavity.
    6·1 answer
  • Which region of the human alimentary tract has both the largest population of bacteria and the greatest species diversity
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!