1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
laiz [17]
3 years ago
15

How many types of fat are there?

Biology
1 answer:
viva [34]3 years ago
5 0
Polyunsaturated fats. The four types<span> have different chemical structures and physical properties. The bad fats, saturated and trans fats, tend to be more solid at room temperature (like a stick of butter), while monounsaturated and polyunsaturated fats tend to be more liquid (like liquid vegetable oil).</span>
You might be interested in
THERE IS NOT A 2ND PART ONLY 1!!!!!!!
sergiy2304 [10]
The answer for this question would be A. Line A
8 0
2 years ago
Read 2 more answers
Stand and let your hands hang next to your sides for a few minutes. Then, look at the backs of your hands. Do you see any bumps
blagie [28]

Answer:

no bumps that i can see

Explanation:

7 0
2 years ago
Why is it so important for measurements in an experiment to be accurate AND precise?
Mashcka [7]
The reason they have to be so accurate and precise is because, let's say you were doing a lab or something that was involving chemicals. If you had to put a certain amount of chemicals in your experiment, but when you were doing to the math, you messed up and didn't go back and even bother to fix it, that is a really BIG issue. Because something will probably happen to your chemicals because you might have added to much of something into it. So that's why you always have to be so precise and accurate!
6 0
3 years ago
Read 2 more answers
Some regions of a polypeptide may coil or fold back on themselves. this is called _____, and the coils or folds are held in plac
Thepotemich [5.8K]
Answer is option C tertiary structure ....hydrogen bonds
3 0
3 years ago
Read 2 more answers
What was the first alive molcule on the Earth?​
Natasha_Volkova [10]
Scientists have inferred that helium hydride was this first, primordial molecule. Once cooling began, hydrogen atoms could interact with helium hydride, leading to the creation of molecular hydrogen — the molecule primarily responsible for the formation of the first stars.
8 0
3 years ago
Read 2 more answers
Other questions:
  • The two insulated beakers shown contain equal amounts of identical liquids. The temperature of Beaker A is 80°C. The temperature
    5·1 answer
  • What does elements do carbohydrates contain
    11·1 answer
  • As DNA is replicated, which DNA base pair will bond to cytosine
    10·1 answer
  • Why is this considered a nonscientific question?<br> "What color is a great horned owl?"
    6·1 answer
  • Hello I need help with this question.
    13·2 answers
  • Which statements describe analogous structures? Select three options. Analogous structures indicate a common ancestor. Analogous
    12·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • In the chemical reaction that forms hydrogen peroxide (H2O2), hydrogen and oxygen share electrons, creating ________ bonds betwe
    7·1 answer
  • I need this very fast!!
    10·2 answers
  • This is the gas produced as a product of photosynthesis
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!