This occurs in dihybrid crosses
There is a 9/16 chance of the offspring have all dominant traits
A 3/16 chance of the offsprings traits being dom/rec or rec/dom
A 1/16 chance of the traits being all recessive.
For example if Tall is dominant to short and Red is dominant to green
9/16ths of the offspring will be Tall and Red
3/16ths will be either Tall and green OR short and Red
1/16ths chance the offspring will be short and green
Answer: The West coast region has the fewest thunderstorms per year
Explanation: Oregon, Washington, California, Alaska and Hawaii are all examples of states in the west coast region of the United States.
The west coast region having the fewest thunderstorms is due to two main factors which are; coldness of the pacific ocean and the dryness of air in the region (Low humidity). These two conditions doesn't give room for the formation of any thunderstorm activity.
The answer is transfer RNA or tRNA.
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer:
the cell wall
Explanation:
cell membrane is not rough and it doesn't support or protect the cell.
cytoplasm is the inner environment of the cell that includes organelles and nutritions. it's not rough and doesn't support or protect the cell.
