1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marin [14]
3 years ago
10

Which is the correct ratio for SINE?

Biology
1 answer:
Vitek1552 [10]3 years ago
3 0

Answer:

opposite/hypotenuse

Explanation:

SOHCAHTOA method, shows that sine is Opposite Hypotenuse.

You might be interested in
Which of these types of weathering requires the presence of water?
serg [7]

Answer:

A. Abrasion

Explanation:

<em>"In abrasion, one rock bumps against another rock. Gravity causes abrasion as a rock tumbles down a mountainside or cliff. Moving water causes abrasion as particles in the water collide and bump against one another."</em>

<em>-Lumen Learning</em>

8 0
3 years ago
Functions of the smooth endoplasmic reticulum include ______. 1
fredd [130]
Transporting lipids.
4 0
3 years ago
Plants are thought to have evolved from aquatic algae. true or false
Yuliya22 [10]

Answer:  false

Explanation:

5 0
2 years ago
I need help plzzzzzzz
igor_vitrenko [27]

Answer:

I think it is the last one D

4 0
3 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Other questions:
  • Homozygous dominant and homozygous recessive
    9·1 answer
  • Unsaturated and saturated lipids exhibit different characteristic based on their structures wich characteristic is unique to sat
    14·1 answer
  • In which taxonomic levels will u find both the ringtail and the human
    8·1 answer
  • What are the parallels? What are the differences?
    13·2 answers
  • Which increases the rate of soil formation?
    8·2 answers
  • One advantage of genetic engineering over selective breeding is what?
    7·1 answer
  • For a multicellular organism, which statement about cellular activity is correct? All cells of the organism carry out most of th
    10·1 answer
  • Please help me anyone wit bio
    14·2 answers
  • Which is an example of a nonfoliated metamorphic rock?<br> marble<br> granite<br> shale<br> slate
    6·1 answer
  • Stem cells are immature cells that do not have a specific function. What causes these cells to become specialized cells such as
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!