1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Flura [38]
3 years ago
5

james suffers from atherosclerosis a condition that causes artery walls to harden and thicken atherosclerosis restricts blood to

flow to organs and tissues the restricted blood flow increases blood flow pressure in which system does atherosclerosis develop
Biology
1 answer:
DENIUS [597]3 years ago
4 0
Atherosclerosis develops in the cardiovascular system.
You might be interested in
In a species of insect, wing length is determined by a single gene, for which there are only two alleles. in a population of 150
Phantasy [73]
I believe the answer is c. because of Darwin's theory of evolution..
3 0
2 years ago
Read 2 more answers
If used with wisdom, the earth has sufficient resources to sustain its human population. True False
romanna [79]
True. If we all work together to conserve our resources, then the earth will be able to sustain its human population. In this century, many people don't really care about conserving resources because they are too careless to think about how much resources we are wasting on a daily basis. If everyone realizes how much resources we are wasting and helps to conserve them, than earth will have sufficient resources to sustain its human population.
hope this helps:)
please mark thanks and brainliest:)
5 0
3 years ago
Read 2 more answers
1. When during the cell cycle is a cell's DNA replicated?
lara31 [8.8K]
1)C S phase 2) B interphase, prophase, metaphase, anaphase, telophase 3) A 4) C
7 0
3 years ago
Read 2 more answers
Which classes are included in the group Tetrapoda?.The choices are: Bony fishes, Amphibia, Reptilia, Aves, and Mammalia. . . . A
Sidana [21]

Amphibia, Reptilia, Aves, and Mammalia are included in the group Tetrapoda. The correct answer between all the choices given is the second choice. I am hoping that this answer has satisfied your query and it will be able to help you in your endeavor, and if you would like, feel free to ask another question.

4 0
3 years ago
Read 2 more answers
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
2 years ago
Other questions:
  • Match the definition to the term
    13·1 answer
  • Because plants do not have skeletons, what accounts for their rigidity?
    7·1 answer
  • Which options describes photosynthesis
    6·2 answers
  • Can someone please help me. Ill give Brainliest plus 20 points. Please help me. I need 500 words. And it has to be true.
    9·1 answer
  • Why is a toxic chemical spill on land potentially harmful to animals that live in the ocean?
    8·2 answers
  • Which of the following strands is the complementary strand to AGG – CTA – AAC?
    11·2 answers
  •  Describe la ruta de sangre a través del corazón y tu cuerpo
    13·1 answer
  • Which occurs just before a volcanic eruption?
    10·2 answers
  • In your own words, define or describe what you<br> already know about photosynthesis?
    10·2 answers
  • Select the correct answer. in cellular respiration, where do the high-energy electrons that move through the electron transport
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!