Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Autotrophs make their own food while heterotrophs do not; because of this, autotrophs may survive in certain situations in which heterotrophs would not.
Hope this helps.
Median cubital vein
Median cubital vein is known
to be superficial vein of the upper limb and it is a vein that connects the
cephalic vein and basilic vein. Median cubital veinare often used for venipuncture
because they lies relatively close to the surface of the arm.
