1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
evablogger [386]
4 years ago
13

What is the electrical current passing through this ammeter?1

Biology
1 answer:
VMariaS [17]4 years ago
7 0
Answer 1: 
Diagram is missing in question. Same is attached below.
Position of needle depicts amount of current flowing through the circuit. From the diagram, it can be seen that deflection needle is in between 8 amperes and 9 amperes. This signifies that, current is more than 8 amperes, but less than 9 amperes. Hence correct answer is option B: 8.5 amperes.


Answer 2: 
Diagram is missing in question. Same is attached below.
A wavelength is the distance between two successive troughs or two successive crests of the wave. Energy, frequency and wavelength of electromagnetic wavelengths are dependent on each other. In present case, X is a true measurement of the wavelenght. Hence, correct answer is option B: X.

Answer 3: 
Diagram is missing in question. Same is attached below.
Magnetic field strength is maximum where the magnetic field density is maximum. From the diagram, it can be seen that, in the region around both north pole and south pole, magnetic field density of identical, as well as very high. Hence, correct answer is option C: Around both poles.


Answer 4: 
<span>Alexandra was preparing to go on a hike in the woods. She gathered the equipment she would need and placed it on the counter. By chance, she placed her compass near an electrical outlet. Although the compass was not moving, the compass needle turned because the electrical current in the outlet produced a magnetic field. 
Reason: </span> When an electric current flows through a circuit, it generates the magnetic field around it. Due to this, the needle of compass got deflected, since it was in vicinity of magnetic field that was generated upon passage of electric current.


Answer 5: 
Diagram is missing in question. Same is attached below.
Correct answer is option B: Using the same number of turns of wire for each electromagnet. This is because, in order to study effect nails in the core of an electromagnet, it would be practical to use same number of batteries and same number of turns of wires in all the experiments. Thus, the variation in magnetism would be solely because of nails present in electromagnet.

Answer 6:
Ms. Markas takes a Thermos bottle filled with hot coffee to work each day. The thermos bottle keeps the coffee hot by slowing heat transfer from the inside to the outside of the container. This is because, thermos acts as in isolated system. An isolated system is one  which does not exchange heat as well as matter with surrounding. Due to this, coffee remains hot for long time.


Answer 7:
Correct answer: Option C-Black T-shirt
Reason: The radiation that is absorbed by the compound is dependent on the energy level separation between different electronic energy level. In energy level separation lies in visible region of electromagnetic radiation, then compound is colored. In case of black colour compounds, it absorbs light of all possible wavelenghts.

Answer 8: 
Diagram is missing in question. Same is attached below.
Correct answer: option B i.e. have a greater frequency than short wavelengths.
Reason:
We know that, E = hv = hc/∧
where, v = frequency of electromagnetic radiation
∧ = wavelenght.

From above equation, it can be seen that frequency and wavelenght have inverse relation. 
Therefore, long wavelengths have a greater frequency than short wavelengths.


Answer 9: 
 Refractive index is  the ratio of the velocity of light in a vacuum to its velocity in a specified medium. In present case, medium used is glass. The best way to determine a glass block's index of refraction is using Snell's Law.

According to Snell's Law, refractive index = \frac{sinQ1}{snQ2}
where, Q1 = angle of incident ray
Q2 = angle of refracted ray. 


Answer 10: 
Joseph studied whether different materials can block certain electromagnetic waves by testing television reception in different parts of the house. At each part of the house, Joseph used a different antenna. The experiment could have been improved by using the same antenna during each trial. Because, currently Joseph has two variable i.e. materials and antenna. This will complicate the experiments, as it would be difficult for Joseph to identify the material  that would be best suited for blocking certain electromagnetic waves. On other hand, if Joseph has used same antenna, there would have been only one variable i.e. materials. 

You might be interested in
A student wants to find out if aspirin helps keep cut flowers fresh. She wants to set up an experiment to test this, but first,
EleoNora [17]
C. If an is added to the water in a vase of daffodils, then the flowers' wilting time will not change because aspirin has no effect on the wilting time of daffodils.
This is the correct answer
3 0
3 years ago
How could you learn what people in a community really believe about health and illness?
skelet666 [1.2K]
We can learn the beliefs and practices of people in the community by community immersion or we will live in there community to observe and interact with the people (participant observation). Doing an initial community diagnosis will identify the most significant health problem in the community. Doing a participatory action research will also make us understand disease in the community.
7 0
3 years ago
(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)
Hatshy [7]

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

4 0
3 years ago
Read 2 more answers
Why are ribosomes necessary for both Prokaryotic and eukaryotic cells to function properly?
Bingel [31]

Answer:

ribosomes are found in both cells

Explanation:

Ribosomes are special because they are found in both prokaryotes and eukaryotes. While a structure such as a nucleus is only found in eukaryotes, every cell needs ribosomes to manufacture proteins. ... The attached ribosomes make proteins that will be used inside the cell and proteins made for export out of the cell

5 0
3 years ago
What elment is found in amino acids that are not found in simple sugers?
amid [387]
Carbon, nitrogen, oxygen, hydrogen
7 0
3 years ago
Other questions:
  • What is Cytomembrane System? How does it work? What are it's parts?
    11·1 answer
  • Which of the following is necessary for glycolysis to begin? Water, ATP, Carbon dioxide, none of the above.
    13·1 answer
  • Which of the following is an environmental cost of agricultural
    5·2 answers
  • For this question, look at the hydrologic cycle diagram.
    8·2 answers
  • What do sea stars have on the bottom of their feet that allows them to stay anchored on a rock or at the bottom of the ocean?
    15·2 answers
  • Light is an example of what in an ecosystem?
    14·2 answers
  • One important way In which banks make economic growth possible is by
    10·1 answer
  • What are two purposes of the cell cycle
    11·2 answers
  • An engine can exert a force of 1 000 newtons. how fast can this engine accelerate
    9·1 answer
  • Please Help me (I'll give brainlest) (LIMITED)
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!