1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Otrada [13]
3 years ago
6

HELP ME PLEASE!!!!!!!!!!

Biology
1 answer:
LenKa [72]3 years ago
7 0

Answer:

1. c. amount of sediment present in water.  2. B) a biotic factor limiting an abiotic factor

Explanation:

You might be interested in
A human blood cell is placed in fresh water. As a result, water moves _____ the cell
Nuetrik [128]

Answer:

inside

Explanation:

osmosis is where water moves from high water conservation(outside of the cell) to a low water concentration(inside the cell) through the memebrane.

7 0
3 years ago
Read 2 more answers
Lamarck's ideas on evolution were adopted by some Russian scientists, including Michurin and Lysenko in Stalinist Russia. Their
Nastasia [14]

Answer:

yes or no ok

Explanation:

4 0
3 years ago
Open the site in your browser. (If any pop-up windows appear, think about what they indicate about the web site before you close
Alex787 [66]

Answer:

b. 2-4 (somewhat trustworthy; want to check some things)

Explanation:

For to have think of opening the site in my browser, its means i somehow trust the messages on the site. though i may not have full confidence on the site because have not been visiting it frequent.

the point still remains, the source of information to the link to the site might has well be trusted, therefore i will assume the site is somewhat trustworthy; want to check some things.

8 0
3 years ago
Select the correct statement about cellular respiration.
weeeeeb [17]

I dont want to mislead you, but I believe the answer is A because letter B is wrong because plants go through cellular respiration and photosynthesis, whereas animals go through cellular respiration but not photosynthesis, and for C, I've never heard of that so it doesnt seem likely.

6 0
3 years ago
How are respiration and photosynthesis related to each other?
Fittoniya [83]

Answer:

Photosynthesis makes the glucose that is used in cellular respiration to make ATP. The glucose is then turned back into carbon dioxide, which is used in photosynthesis. ... While photosynthesis requires carbon dioxide and releases oxygen, cellular respiration requires oxygen and releases carbon dioxide.

Explanation:

8 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Ron examined several fossils to date Earth events from 443 million years ago to 206 million years ago. Which of these charts bes
    5·1 answer
  • What is the acceleration of.5-kg bowling ball when a 10-n force is applied
    6·1 answer
  • Does the number of chromosomes correspond to the complexity of an organism?
    10·1 answer
  • The build up of hard waste deposits within the kidneys are called kidney ______.
    5·1 answer
  • Complete the statements below. When muscles contract, they become _____. The muscles of the rear end, legs, and feet are called
    11·2 answers
  • Please help!<br>I need to complete this fast​
    7·1 answer
  • All of the following organelles are organelles in plants that differ from humans,
    9·1 answer
  • Weather and climate result from interactions
    7·2 answers
  • I can't find the answer for this what organ system is affected by albinism<br> plz help
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!