1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
My name is Ann [436]
3 years ago
9

When you get excited and your adrenaline starts pumping, your body is experiencing evolution?? true or false

Biology
1 answer:
alekssr [168]3 years ago
4 0
<span>When you get excited and your adrenaline starts pumping, your body is not experiencing evolution, so f</span>alse
You might be interested in
Which of the following methods of agriculture is the most reliant upon technology and automation
kirza4 [7]
I believe "Dutch Agriculture" is the answer you are looking for.
7 0
3 years ago
Describe the function of three areas of the brain (you choose which areas).
Bezzdna [24]

Answer:

Brain is the main coordination center of the body and regulates the proper functioning of the body. Brain is divided into three parts- forebrain, midbrain and hindbrain.

Cerebrum: Crerebrum is the largest part of brain and controls the language, communication ability, and the process of learning and memory of an organism.

Hypothalamus: Hypothalamus is located at the base of a brain. Hypothalamus releases various hormones, regulates the body temperature and manages the sexual behavior of an organism.

Thalamus: Thalamus is located above the brain stem and relay the neurons into the cerebral cortex. Thalamus regulates alertness, wakefulness and sleep of an organism.

6 0
3 years ago
Select ALL of the following genotypes below that respresent males.
Zepler [3.9K]

Answer:

Is it XXX that all males want?

Explanation:

Just joking! I still think it is XXY

6 0
3 years ago
This is information collected by observation or experimentation. It is recorded and analyzed by scientists.
natali 33 [55]
Data? is what i think would work
5 0
3 years ago
Read 2 more answers
How do plant roots "know" to grow downward? This is a plant response called
Dima020 [189]
A) gravitropism is how they "know"
3 0
3 years ago
Read 2 more answers
Other questions:
  • How do covalent molecules form?
    8·1 answer
  • What substance diffuses across the membrane in osmosis
    12·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Would you say a leaf cell or a leaf vessel or a leaf tissue or something else?!?
    6·1 answer
  • The results of a scientific investigation either supports a claim or do not support a claim; they do not offer conclusive BLANK
    6·1 answer
  • What is the ratio of surface area to volume for a sphere with the following
    8·2 answers
  • Clear selectic 5 po 14. A group of high school students wanted to use a decibel meter to test whether or not their classroom was
    11·1 answer
  • 4)A machine can produce 120 candies in
    13·1 answer
  • HELP ME ASP A scientific theory....
    13·1 answer
  • In the form of gene therapy used successfully for severe combined immunodeficiency syndrome, SCID-X 1, how is the genetic engine
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!