Answer:
B. Australia is isolated
Explanation:
They originated in South America and spread throughout the world, but due to competition on other continents, the other marsupials died out, while the ones on Australia lived.
Answer:
All living cells release energy from food molecules through cellular respiration and/or fermentation. Some cells make food molecules using light energy through the process of photosynthesis.
Two ways to cells get energy: cellular respiration and fermentation.
Fermentation: Fermentation, chemical process by which molecules such as glucose are broken down anaerobically.
Cellular respiration: Cellular respiration is the process through which cells convert sugars into energy. To create ATP and other forms of energy to power cellular reactions, cells require fuel and an electron acceptor which drives the chemical process of turning energy into a useable form.
<h3><em>Hope this helps, I tried to make it as simple as possible because I know how confusing these things can get!! Have a nice day :) -KindnessMatters-</em></h3>
Answer:
We might lose things such as plastic bags, water bottles cardboard and glass it would be a shame if any of these things got lost we could be using the glass to help us build structures or we can even build things out of plastic and we can try helping people by building gains Lego blocks to craft out a house for them.
The Yellowstone River ecosystem can support 2,300 bald eagles. This is an example of<u> temperate- zone ecosystems</u>
Explanation:
Yellowstone National Park is a natural paradise with over 70 species of birds,which include trumpeter swans, sandhill cranes, loons, peregrine falcons, osprey and bald eagles
The Greater Yellowstone Ecosystem, with Yellowstone at its core, is one of the largest nearly intact temperate- zone ecosystems on Earth. It has an area of 12–22 million acres; 18,750– 34,375 square miles
<u>Temperate ecosystems are the ecosystem that are characterized by the seasonality in temperature, with cooler winters and warmer summers, and also show various seasonality in precipitation patterns, resulting from seasonal changes in the orientation of Earth's axis relative to the sun.</u>
<u></u>
The Yellowstone River ecosystem can support 2,300 bald eagles. This is an example of<u> temperate- zone ecosystems</u>
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
