1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natalka [10]
3 years ago
14

Lupus, a condition in which the body attacks its own cells, is an example ofLupus, a condition in which the body attacks its own

cells, is an example of
Biology
2 answers:
Sedaia [141]3 years ago
5 0
Can you explain a little more about the question please?
vazorg [7]3 years ago
3 0

The right answer is autoimmune disease.

Autoimmune diseases are the result of a reversal of the immune system of an individual against some of its own cells, even against all of one or more organs. Little known by this scholarly name, autoimmune diseases represent the third cause of morbidity in developed countries (after cardiovascular diseases and cancers); we will be less surprised when we learn that among them are widespread diseases such as type 1 diabetes, rheumatoid arthritis or multiple sclerosis.

You might be interested in
The magic word is:
Kruka [31]

Answer:

What is this off of, can you give me more information so I can help you

Explanation:

7 0
3 years ago
¿Qué probabilidad tiene una pareja de polidacticos heterocigoticos de tener un hijo no polidactico?
Amiraneli [1.4K]

Answer:

how to speak taco

Explanation:

6 0
3 years ago
According to the food chain, label the following organisns appropriately
aniked [119]
2rabbit   4snake   1owl   3carrot
4 0
3 years ago
Explain the difference between a monohybrid cross and a dihybrid cross, and give an example of each.
Kay [80]
Monohybrid crosses only look at one genotype. Whereas dihybrid crosses look at two genotypes.
An example of a monohybrid cross would be AA x aa, where A represents the dominant allele, and its phenotype is the colour red, and a represents the recessive allele, and its phenotype is the colour white. 
An example of a dihybrid cross would be SSYY x SsYy, where the letter S represents the size, dominant phenotype is large, recessive is small, and Y represents the colour, dominant phenotype is yellow, recessive is green.
4 0
3 years ago
Need number3 and 4, what does that mean to trace the descent, what should I write
LekaFEV [45]
For number 3, Queen  Victoria's children and Queen Elizabeth II's descendants  are Edward VII, George V, George VI
for number 4, the descendants of Philip of Greece are Alice, Victoria of Hesse, Alice of battenburg
6 0
3 years ago
Read 2 more answers
Other questions:
  • Describe the role / function of mrna, trna and rRna
    7·1 answer
  • The nursing instructor is teaching a pre-nursing pathophysiology class. the class is covering the respiratory system. the instru
    9·1 answer
  • The diagram below shows the layers in a rock having a brachiopod: A rock column labeled Rock is shown. The column has three laye
    13·2 answers
  • What might happen to the food web below if the number of phytoplankton drastically decreased? The small fish and wading birds wo
    12·2 answers
  • Which of the following is best for representing a time period in which an organism could evolve (for evolution to happen)? A 3,0
    12·1 answer
  • Match each theory to its best description.
    10·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Which of the following is an example of a diploid cell?
    5·1 answer
  • 17. Which of the following is an acid?
    9·2 answers
  • Question 2 of 10
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!